Potassium channel interactors and uses therefor

专利摘要:
The present invention provides an isolated nucleic acid molecule, referred to as a PCIP nucleic acid molecule, that encodes a protein that binds to a potassium channel and modulates potassium channel mediated activity. The invention also provides antisense nucleic acid molecules, recombinant expression vectors containing PCIP nucleic acid molecules, host cells into which expression vectors have been introduced, and transgenic animals other than humans into which the PCIP gene has been introduced or disrupted. The invention also provides isolated PCIP proteins, fusion proteins, antigenic peptides and anti-PCIP antibodies. Diagnostics using the compositions of the present invention are also provided.
公开号:KR20030074604A
申请号:KR10-2003-7004460
申请日:2001-09-27
公开日:2003-09-19
发明作者:케네쓰 로우즈；마리아 베티；후아이-핑 링；웬키안 안
申请人:밀레니엄 파머슈티컬스 인코퍼레이티드；
IPC主号:

专利说明:

Potassium channel interactors and their use {POTASSIUM CHANNEL INTERACTORS AND USES THEREFOR}
[1] Mammalian cell membranes are important for the maintenance and activity of many cells and tissues. Of particular interest in membrane physiology is the study of transmembrane and ion channels that directly regulate various pharmacological, physiological and cellular functions. Many ion channels have been identified, including calcium, sodium and potassium channels, each of which has been investigated to determine its role in vertebrate cells and insect cells.
[2] Much attention has been given to potassium channels, as they are involved in maintaining normal cell homeostasis. A significant number of these potassium channels open in response to changes in cell membrane potential. Many voltage-gated potassium channels have been identified and characterized by their electrophysiological and pharmacological properties. Potassium currents are more diverse than sodium and calcium currents and are further involved in determining the cell's response to external stimuli. The diversity of potassium channels and their important physiological roles highlight their potential as targets for developing therapeutics for various diseases.
[3] One most characteristic class of potassium channels is voltage-gated potassium channels. Prototypes of this class are proteins encoded by the Drosophila shaker gene. Proteins of the Shell or Kv4 family are one type of voltage-gated potassium channel that underlies many natural A-type currents recorded from different first cells. Kv4 channels play a major role in the repolarization of cardiac action potentials. In neurons, Kv4 channels and the A currents they may contain play an important role in regulating the firing rate, initiating action potential and regulating the dendritic response to synaptic input.
[4] The basic function of a neuron is to receive, process, and transmit signals. Despite the various purpose signals carried by the different classes of neurons, the form of the signal is always the same and consists of a change in potential across the plasma membrane of the neuron. The plasma membrane of neurons contains voltage-gated cation channels, which are responsible for propagating these potentials (also called action potentials or nerve impulses) across the plasma membrane along the plasma membrane.
[5] The channels of the Kv family include, among other things, (1) delayed rectifier potassium channels that prepare the cells to re-ignite by repolarizing the membrane after each action potential, and (2) cells that are predominantly active and excitable at subthreshold voltage. Fast deactivation (type A) potassium channels that act to reduce the rate of reaching the ignition threshold. In addition to being important for action potential conduction, Kv channels also play a role in regulating responses to depolarization, eg, synaptic input, and releasing neurotransmitters. As a result of this activity, voltage-gated potassium channels are the major regulators of neuronal excitability (Hille B., Ionic Channels of Excitable Membranes, Second Edition, Sunderland, MA: Sinauer, (1992)).
[6] There is a great deal of structural and functional diversity within the Kv potassium channel superfamily. This diversity is caused by both the presence of the multigene and the alternating splicing of RNA transcripts produced from the same gene. Nevertheless, the amino acid sequence of known Kv potassium channels shows high similarity. All channels are believed to be composed of four pore-forming α-subunits, some of which are known to have four cytoplasmic (β-subunit) polypeptides. Jan L. Y. et al. (1990) Trends Neurosci 13: 415-419, and Pongs, O. et al. (1995) Sem Neurosci. 7: 137-146). Known Kv channels (α-subunits belong to four subfamily named due to their homology to channels originally isolated from Drosophila: Kv1, or Shaker related subfamily; Kv2, or Sheb Related subfamily; Kv3, or Shaw related subfamily; and Kv4, or Shell related subfamily.
[7] Kv4.2 and Kv4.3 are examples of Kv channels (α-subunits) of shell-related subfamily. Kv4.3 is a unique neurological solution in that its mRNA is highly expressed in hepatic brain monoamine neurons and whole brain cholinergic neurons. It has a negative distribution and is involved in the release of the neurotransmitters dopamine, norepinephrine, serotonin and acetylcholine.
[8] In addition, these channels are highly expressed in cortical pyramidal cells and intermediate neurons. See Serdio P. et al. (1996) J. Neurophys 75: 2174-2179. Interestingly, Kv4.3 polypeptides are highly expressed in neurons that express corresponding mRNAs. Kv4.3 polypeptides are expressed in the cytosolic membranes of these cells, where they are thought to contribute to the rapid inactivation of K ⁺ conduction. Kv4.2 mRNA is widely expressed in the brain, and the corresponding polypeptide is also believed to be enriched in the cytosolic membrane, where it contributes to the rapid inactivation of K ⁺ conduction [Sheng et al. (1992) Neuron 9: 271-284. These dendritic A-type Kv channels, such as Kv4.2 and Kv4.3, seem to be involved in mechanisms underlying learning and memory, such as the maintenance of sub-synaptic responses and the conduction of back-propagating action potentials. Hoffman DA et al. (1997) Nature 387: 869-875.
[9] Thus, potassium channel proteins, such as proteins that interact with and regulate the activity of potassium channels with Kv4.2 or Kv4.3 subunits, may be neurons or cardiac excitability, eg, activity, in cells expressing such channels. Provided are novel molecular targets for regulating potential conduction, cell dendritic excitability and neurotransmitter release. In addition, detection of gene damage in genes encoding such proteins can include central nervous system diseases such as epilepsy, spinal cerebellar ataxia, anxiety, depression, aging memory loss, migraine, obesity, Parkinson's disease or Alzheimer's disease; Or in cardiovascular diseases such as heart failure, hypertension, atrial fibrillation, dilated cardiomyopathy, idiopathic cardiomyopathy, or angina.
[10] Summary of the Invention
[11] The present invention finds a novel nucleic acid molecule encoding a gene product (paralog) that has a significant homology to a gene product that interacts with potassium channel proteins or a gene product of the invention that interacts with potassium channel proteins. Is based at least in part. Potassium channel proteins are, for example, potassium channels with Kv4.2 or Kv4.3 subunits. The nucleic acid molecules of the present invention and their gene products are referred to herein as "potassium channel interacting proteins", "PCIP", or "KChIP" nucleic acids and protein molecules. The PCIP proteins of the invention interact with, eg, bind to, potassium channel proteins, modulate the action of potassium channel proteins and / or modulate potassium channel mediated activity in cells such as neuronal cells or heart cells. . The PCIP molecules of the present invention are useful as modulators for regulating various cellular functions, for example neuronal cells or cardiac cell functions. Thus, in one embodiment, the present invention provides nucleic acid fragments suitable as primers or hybridization probes for the detection of PCIP encoding nucleic acids as well as isolated nucleic acid molecules or their biologically active portions encoding PCIP proteins.
[12] In one embodiment, the PCIP nucleic acid molecule of the invention is SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 5, SEQ ID NO: 7, SEQ ID NO: 9, SEQ ID NO: 11, SEQ ID NO: 13, SEQ ID NO: 15, SEQ ID NO: 17, SEQ ID NO: 19, SEQ ID NO: 21, SEQ ID NO: 23, SEQ ID NO: 25, SEQ ID NO: 27, SEQ ID NO : 29, SEQ ID NO: 31, SEQ ID NO: 33, SEQ ID NO: 35, SEQ ID NO: 37, SEQ ID NO: 39, SEQ ID NO: 48, SEQ ID NO: 50, SEQ ID NO: 52 , SEQ ID NO: 54, SEQ ID NO: 56, SEQ ID NO: 58, SEQ ID NO: 69, SEQ ID NO: 71, SEQ ID NO: 74, SEQ ID NO: 75, SEQ ID NO: 77, SEQ ID NO: 79, SEQ ID NO: 80, SEQ ID NO: 82, SEQ ID NO: 84, SEQ ID NO: 86, SEQ ID NO: 88, SEQ ID NO: 90, SEQ ID NO: 92, SEQ ID NO : 94, SEQ ID NO: 96, SEQ ID NO: 98, SEQ ID NO: 100, or the nucleotide sequence set forth in SEQ ID NO: 102 (eg, full length nucleotide sequence), Accession No. 98936, 98937, No. 98938, 98939, 98940, 98941, 98942, 98943, 98944, 98945, 98946, 98947, 98948, 98949, 98950 , 9895 At least 50%, 55%, 60%, 65%, 70%, 75 of the nucleotide sequence of the DNA insertion sequence of the plasmid deposited with the ATCC or its complementary sequence as 1, 98991, 98993 or 98994; The same is true for%, 80%, 85%, 90%, 95%, and 98%.
[13] In another preferred embodiment, the isolated nucleic acid molecule comprises SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 5, SEQ ID NO: 7, SEQ ID NO: 9, SEQ ID NO: 11, SEQ ID NO: 13, SEQ ID NO: 15, SEQ ID NO: 17, SEQ ID NO: 19, SEQ ID NO: 21, SEQ ID NO: 23, SEQ ID NO: 25, SEQ ID NO: 27, SEQ ID NO: 29, SEQ ID NO: 31, SEQ ID NO: 33, SEQ ID NO: 35, SEQ ID NO: 37, SEQ ID NO: 39, SEQ ID NO: 48, SEQ ID NO: 50, SEQ ID NO: 52, SEQ ID NO: 54, SEQ ID NO: 56, SEQ ID NO: 58, SEQ ID NO: 69, SEQ ID NO: 71, SEQ ID NO: 74, SEQ ID NO: 75, SEQ ID NO: 77, SEQ ID NO: 79, SEQ ID NO: 80, SEQ ID NO: 82, SEQ ID NO: 84, SEQ ID NO: 86, SEQ ID NO: 88, SEQ ID NO: 90, SEQ ID NO: 92, SEQ ID NO: 94, SEQ ID NO: 96, SEQ ID NO: 98, SEQ ID NO: 100, or the nucleotide sequence set forth in SEQ ID NO: 102 or a complementary sequence thereof. In another preferred embodiment, the nucleic acid molecule has SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 5, SEQ ID NO: 7, SEQ ID NO: 9, SEQ ID NO: 11, SEQ ID NO: 13, SEQ ID NO: 15, SEQ ID NO: 17, SEQ ID NO: 19, SEQ ID NO: 21, SEQ ID NO: 23, SEQ ID NO: 25, SEQ ID NO: 27, SEQ ID NO: 29, SEQ ID NO: 31, SEQ ID NO: 33, SEQ ID NO: 35, SEQ ID NO: 37, SEQ ID NO: 39, SEQ ID NO: 48, SEQ IDNO: 50, SEQ ID NO: 52, SEQ ID NO : 54, SEQ ID NO: 56, SEQ ID NO: 58, SEQ ID NO: 69, SEQ ID NO: 71, SEQ ID NO: 74, SEQ ID NO: 75, SEQ ID NO: 77, SEQ ID NO: 79 , SEQ ID NO: 80, SEQ ID NO: 82, SEQ ID NO: 84, SEQ ID NO: 86, SEQ ID NO: 88, SEQ ID NO: 90, SEQ ID NO: 92, SEQ ID NO: 94, SEQ 300, 350, 400, 426, 471, or 583 of the nucleotide sequence of ID NO: 96, SEQ ID NO: 98, SEQ ID NO: 100, or SEQ ID NO: 102 or their complementary sequences And fragments of the above nucleotides.
[14] In another embodiment, the PCIP nucleic acid molecule comprises SEQ ID NO: 2, SEQ ID NO: 4, SEQ ID NO: 6, SEQ ID NO: 8, SEQ ID NO: 10, SEQ ID NO: 12, SEQ ID NO: 14, SEQ ID NO: 16, SEQ ID NO: 18, SEQ ID NO: 20, SEQ ID NO: 22, SEQ ID NO: 24, SEQ ID NO: 26, SEQ ID NO: 28, SEQ ID NO: 30, SEQ ID NO: 32, SEQ ID NO: 34, SEQ ID NO: 36, SEQ ID NO: 38, SEQ ID NO: 40, SEQ ID NO: 49, SEQ ID NO: 51, SEQ ID NO: 53, SEQ ID NO: 55, SEQ ID NO: 57, SEQ ID NO: 59, SEQ ID NO: 70, SEQ ID NO: 72, SEQ ID NO: 76, SEQ ID NO: 78, SEQ ID NO: 81, SEQ ID NO: 83, SEQ ID NO: 85, SEQ ID NO: 87, SEQ ID NO: 89, SEQ ID NO: 91, SEQ ID NO: 93, SEQ ID NO: 95, SEQ ID NO: 97, SEQ ID NO: 99, Amino acid sequence of SEQ ID NO: 101, SEQ ID NO: 103, or SEQ ID NO: 109 or Accession Nos. 98936, 98937, 98938, 98939, 98940, 98941, 98942 No. 98943, 98944, 98945, 98946, 98947, 98948, 98949, 98950, 98951, 98991, 98993 or 98994. Players deposited with ATCC It comprises a nucleotide sequence that enough encoding a protein having the same amino acid sequence and amino acid sequence encoding a protein having the DNA sequence inserted in the plasmid. In a preferred embodiment, the PCIP nucleic acid molecule is SEQ ID NO: 2, SEQ ID NO: 4, SEQ ID NO: 6, SEQ ID NO: 8, SEQ ID NO: 10, SEQ ID NO: 12, SEQ ID NO: 14 , SEQ ID NO: 16, SEQ ID NO: 18, SEQ ID NO: 20, SEQ ID NO: 22, SEQ ID NO: 24, SEQ ID NO: 26, SEQ ID NO: 28, SEQ ID NO: 30, SEQ ID NO: 32, SEQ ID NO: 34, SEQ ID NO: 36, SEQ ID NO: 38, SEQ ID NO: 40, SEQ ID NO: 49, SEQ ID NO: 51, SEQ ID NO: 53, SEQ ID NO : 55, SEQ ID NO: 57, SEQ ID NO: 59, SEQ ID NO: 70, SEQ ID NO: 72, SEQ ID NO: 76, SEQ ID NO: 78, SEQ ID NO: 81, SEQ ID NO: 83 , SEQ ID NO: 85, SEQ ID NO: 87, SEQ ID NO: 89, SEQ ID NO: 91, SEQ ID NO: 93, SEQ ID NO: 95, SEQ ID NO: 97, SEQ ID NO: 99, SEQ Amino acid sequence of SEQ ID NO: 101, SEQ ID NO: 103, or SEQ ID NO: 109 or Accession Nos. 98936, 98937, 98938, 98939, 98940, 98941, 98942 ATCC as 98943, 98944, 98945, 98946, 98947, 98948, 98949, 98950, 98951, 98991, 98993 or 98994. Deposited in A protein having at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95% or more identical amino acid sequence encoded by the DNA insertion sequence of Rasmid Nucleotide sequences that encode.
[15] In another preferred embodiment, the isolated nucleic acid molecule encodes the amino acid sequences of the 1v, 9q, p19, W28559, KChIP4a, KChIP4b, 33b07, 1p, and rat 7s proteins. Furthermore, in another preferred embodiment, the nucleic acid molecule is SEQ ID NO: 2, SEQ ID NO: 4, SEQ ID NO: 6, SEQ ID NO: 8, SEQ ID NO: 10, SEQ ID NO: 12, SEQ ID NO: 14, SEQ ID NO: 16, SEQ ID NO: 18, SEQ ID NO: 20, SEQ ID NO: 22, SEQ ID NO: 24, SEQ ID NO: 26, SEQ IDNO: 28, SEQ ID NO: 30 , SEQ ID NO: 32, SEQ ID NO: 34, SEQ ID NO: 36, SEQ ID NO: 38, SEQ ID NO: 40, SEQ ID NO: 49, SEQ ID NO: 51, SEQ ID NO: 53, SEQ ID NO: 55, SEQ ID NO: 57, SEQ ID NO: 59, SEQ ID NO: 70, SEQ ID NO: 72, SEQ ID NO: 76, SEQ ID NO: 78, SEQ ID NO: 81, SEQ ID NO : 83, SEQ ID NO: 85, SEQ ID NO: 87, SEQ ID NO: 89, SEQ ID NO: 91, SEQ ID NO: 93, SEQ ID NO: 95, SEQ ID NO: 97, SEQ ID NO: 99 , SEQ ID NO: 101, SEQ ID NO: 103, or the amino acid sequence of SEQ ID NO: 109 or Accession Nos. 98936, 98937, 98938, 98939, 98940, 98941, 9 98942, 98943, 98944, 98945, 98946, 98947, 98948, 98949, 98950, 98951, 98991, 98993 or 98994 ATCC as Nucleotide sequence encoding a protein having an amino acid sequence encoded by the DNA insertion of a deposited plasmid. In another preferred embodiment, the nucleic acid molecule encodes a protein that is at least 426, 471 or 583 nucleotides in length and has PCIP activity (as described herein).
[16] Another embodiment of the invention features a nucleic acid molecule, preferably a PCIP nucleic acid molecule, which specifically detects a PCIP nucleic acid molecule with respect to a nucleic acid molecule encoding a non-PCIP protein. For example, in one embodiment, such nucleic acid molecules are at least 426, 400-450, 471, 450-500, 500-550, 583, 550-600, 600 to 650, 650 to 700, 700 to 750, 750 to 800 or more nucleotides and under stringent conditions SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 5, SEQ ID NO: 7, SEQ ID NO: 9, SEQ ID NO: 11, SEQ IDNO: 13, SEQ ID NO: 15, SEQ ID NO: 17, SEQ ID NO: 19, SEQ ID NO: 21, SEQ ID NO: 23 , SEQ ID NO: 25, SEQ ID NO: 27, SEQ ID NO: 29, SEQ ID NO: 31, SEQ ID NO: 33, SEQ ID NO: 35, SEQ ID NO: 37, SEQ ID NO: 39, SEQ ID NO: 48, SEQ ID NO: 50, SEQ ID NO: 52, SEQ ID NO: 54, SEQ ID NO: 56, SEQ ID NO: 58, SEQ ID NO: 69, SEQ ID NO: 71, SEQ ID NO : 74, SEQ ID NO: 75, SEQ ID NO: 77, SEQ ID NO: 79, SEQ ID NO: 80, SEQ ID NO: 82, SEQ ID NO: 84, SEQ ID NO: 86, SEQ ID NO: 88 Nucleotide set forth in SEQ ID NO: 90, SEQ ID NO: 92, SEQ ID NO: 94, SEQ ID NO: 96, SEQ ID NO: 98, SEQ ID NO: 100, or SEQ ID NO: 102 Sequence No. 98936, 98937, 98938, 98939, 98940, 98941, 98942, 98943, 98944, 98945, 98946, 98947 Nucleic acid molecules comprising DNA insertion sequences of plasmids deposited in ATCC as No. 98948, 98949, 98950, 98951, 98991, 98993 or 98994, or their complementary sequences Hybridized to. In a preferred embodiment, the nucleic acid molecule is at least 15 nucleotides in length (eg, in succession) and under strict conditions the nucleotides 93-126, 360-462, 732-825, 1028-1054, of SEQ ID NO: 7, Or hybridize to 1517-1534. In another preferred embodiment, the nucleic acid molecule comprises nucleotides 93-126, 360-462, 732-825, 1028-1054, or 1517-1534 of SEQ ID NO: 7.
[17] In another preferred embodiment, the nucleic acid molecule is at least 15 nucleotides in length (eg, in succession) and under stringent conditions nucleotides 1-14, 49-116, 137-311, 345-410 of SEQ ID NO: 13. , 430-482, 503-518, 662-693, 1406-1421, 1441-1457, 1478-1494, or 1882-1959. In another preferred embodiment, the nucleic acid molecule is nucleotides 1-14, 49-116, 137-311, 345-410, 430-482, 503-518, 662-693, 1406-1421, 1441- of SEQ ID NO: 13. 1457, 1478-1494, or 1882-1959.
[18] In a preferred embodiment, the nucleic acid molecule is at least 15 nucleotides in length (eg, in succession) and under stringent conditions nucleotides 932-1527, 1548-1765, 1786-1871, 1908-2091, of SEQ ID NO: 35, Hybridized to 2259-2265, or 2630-2654. In another preferred embodiment, the nucleic acid molecule comprises nucleotides 932-1527, 1548-1765, 1786-1871, 1908-2091, 2259-2265, or 2630-2654 of SEQ ID NO: 35.
[19] In another preferred embodiment, the nucleic acid molecule is SEQ ID NO: 2, SEQ ID NO: 4, SEQ ID NO: 6, SEQ ID NO: 8, SEQ ID NO: 10, SEQ ID NO: 12, SEQ ID NO: 14 , SEQ ID NO: 16, SEQ ID NO: 18, SEQ ID NO: 20, SEQ ID NO: 22, SEQ ID NO: 24, SEQ ID NO: 26, SEQ ID NO: 28, SEQ ID NO: 30, SEQ ID NO: 32, SEQ ID NO: 34, SEQ ID NO: 36, SEQ ID NO: 38, SEQ ID NO: 40, SEQ ID NO: 49, SEQ ID NO: 51, SEQ ID NO: 53, SEQ ID NO : 55, SEQ ID NO: 57, SEQ ID NO: 59, SEQ ID NO: 70, SEQ ID NO: 72, SEQ ID NO: 76, SEQ ID NO: 78, SEQ ID NO: 81, SEQ ID NO: 83 , SEQ ID NO: 85, SEQ ID NO: 87, SEQ ID NO: 89, SEQ ID NO: 91, SEQ ID NO: 93, SEQ ID NO: 95, SEQ ID NO: 97, SEQ ID NO: 99, SEQ Amino acid sequence of SEQ ID NO: 101, SEQ ID NO: 103, or SEQ ID NO: 109 or Accession Nos. 98936, 98937, 98938, 98939, 98940, 98941, 98942 ATCC as 98943, 98944, 98945, 98946, 98947, 98948, 98949, 98950, 98951, 98991, 98993 or 98994. Deposited in Encoding a natural allelic variant of a polypeptide comprising an amino acid sequence encoded by the DNA insert of lasmid, wherein the nucleic acid molecule is subjected to stringent conditions under SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 5, SEQ ID NO: 7, SEQ ID NO: 9, SEQ ID NO: 11, SEQ ID NO: 13, SEQ ID NO: 15, SEQ ID NO: 17, SEQ ID NO: 19, SEQ ID NO: 21, SEQ ID NO: 23, SEQ ID NO: 25, SEQ ID NO: 27, SEQ ID NO: 29, SEQ ID NO: 31, SEQ ID NO: 33, SEQ ID NO: 35, SEQ ID NO: 37, SEQ ID NO: 39, SEQ ID NO: 48, SEQ ID NO: 50, SEQ ID NO: 52, SEQ ID NO: 54, SEQ ID NO: 56, SEQ ID NO: 58, SEQ ID NO: 69, SEQ ID NO: 71, SEQ ID NO: 74, SEQ ID NO: 75, SEQ ID NO: 77, SEQ ID NO: 79, SEQ ID NO: 80, SEQ ID NO: 82, SEQ ID NO: 84, SEQ ID NO: 86, SEQ ID Nucleic acid comprising NO: 88, SEQ ID NO: 90, SEQ ID NO: 92, SEQ ID NO: 94, SEQ ID NO: 96, SEQ ID NO: 98, SEQ ID NO: 100, or SEQ ID NO: 102 Hybridized to the molecule.
[20] Another embodiment of the invention provides an isolated nucleic acid molecule that is antisense to the coding strand of a PCIP nucleic acid molecule, eg, a PCIP nucleic acid molecule.
[21] Another aspect of the invention provides a vector comprising a PCIP nucleic acid molecule. In certain embodiments, the vector is a recombinant expression vector. In another embodiment, the present invention provides a host cell containing the vector of the present invention. The present invention also provides a method for producing a protein, preferably a PCIP protein, which method comprises culturing a mammalian host cell of the invention, such as a host cell, preferably a mammalian cell other than a human, in a suitable medium. Provides a method for producing protein.
[22] Another aspect of the invention features isolated or recombinant PCIP proteins and polypeptides. In one embodiment, the isolated protein, preferably PCIP protein, comprises one or more calcium binding domains. In one preferred embodiment, the protein, preferably the PCIP protein, comprises at least one calcium binding domain and comprises SEQ ID NO: 2, SEQ ID NO: 4, SEQ ID NO: 6, SEQ ID NO: 8, SEQ ID NO: 10, SEQ ID NO: 12, SEQ ID NO: 14, SEQ ID NO: 16, SEQ ID NO: 18, SEQ ID NO: 20, SEQ ID NO: 22, SEQ ID NO: 24, SEQ ID NO: 26, SEQ ID NO: 28, SEQ ID NO: 30, SEQ ID NO: 32, SEQ ID NO: 34, SEQ ID NO: 36, SEQ ID NO: 38, SEQ ID NO: 40, SEQ ID NO: 49, SEQ ID NO: 51, SEQ ID NO: 53, SEQ ID NO: 55, SEQ ID NO: 57, SEQ ID NO: 59, SEQ ID NO: 70, SEQ ID NO: 72, SEQ ID NO: 76, SEQ ID NO: 78, SEQ ID NO: 81, SEQ ID NO: 83, SEQ ID NO: 85, SEQ ID NO: 87, SEQ ID NO: 89, SEQ ID NO: 91, SEQ ID NO: 93, SEQ ID NO: 95, SEQ ID NO: 97, SEQ ID NO: 99, SEQ ID NO: 101, SEQ ID NO: 103, or the amino acid sequence of SEQ ID NO: 109 or Accession Nos. 98936, 98937, 98938, 98939, 98940, 98941, 98942, 98943, 98944, 98945, 98946, 98947, 98948, 98949, 98 At least 50%, 55%, 60%, 65%, 70% of the amino acid sequence encoded by the DNA insertion of the plasmid deposited with ATCC as 950, 98951, 98991, 98993 or 98994. At least 75%, 80%, 85%, 90%, 95% identical amino acid sequences. In another preferred embodiment, the protein, preferably PCIP protein, comprises one or more calcium binding domains and modulates potassium channel mediated activity. In another preferred embodiment, the protein, preferably the PCIP protein, comprises at least one calcium binding domain and under stringent hybridization conditions SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 5, SEQ ID NO: 7, SEQ ID NO: 9, SEQ ID NO: 11, SEQ ID NO: 13, SEQ ID NO: 15, SEQ ID NO: 17, SEQ ID NO: 19, SEQ ID NO: 21, SEQ ID NO : 23, SEQ ID NO: 25, SEQ ID NO: 27, SEQ ID NO: 29, SEQ ID NO: 31, SEQ ID NO: 33, SEQ ID NO: 35, SEQ ID NO: 37, SEQ ID NO: 39 , SEQ ID NO: 48, SEQ ID NO: 50, SEQ ID NO: 52, SEQ ID NO: 54, SEQ ID NO: 56, SEQ ID NO: 58, SEQ ID NO: 69, SEQ ID NO: 71, SEQ ID NO: 74, SEQ ID NO: 75, SEQ ID NO: 77, SEQ ID NO: 79, SEQ ID NO: 80, SEQ ID NO: 82, SEQ ID NO: 84, SEQ ID NO: 86, SEQ ID NO : 88, SEQ ID NO: 90, SEQ ID NO: 92, SEQ ID NO: 94, SEQ ID NO: 96, SEQ ID NO: 98, SEQ ID NO: 100, or the nucleotide sequence of SEQ ID NO: 102 Encoded by a nucleic acid molecule having a nucleotide sequence that hybridizes to the nucleic acid molecule.
[23] In another embodiment, the present invention provides SEQ ID NO: 2, SEQ ID NO: 4, SEQ ID NO: 6, SEQ ID NO: 8, SEQ ID NO: 10, SEQ ID NO: 12, SEQ ID NO: 14 , SEQ ID NO: 16, SEQ ID NO: 18, SEQ ID NO: 20, SEQ ID NO: 22, SEQ ID NO: 24, SEQ ID NO: 26, SEQ ID NO: 28, SEQ ID NO: 30, SEQ ID NO: 32, SEQ ID NO: 34, SEQ ID NO: 36, SEQ ID NO: 38, SEQ ID NO: 40, SEQ ID NO: 49, SEQ ID NO: 51, SEQ ID NO: 53, SEQ ID NO : 55, SEQ ID NO: 57, SEQ ID NO: 59, SEQ ID NO: 70, SEQ ID NO: 72, SEQ ID NO: 76, SEQ ID NO: 78, SEQ ID NO: 81, SEQ ID NO: 83 , SEQ ID NO: 85, SEQ ID NO: 87, SEQ ID NO: 89, SEQ ID NO: 91, SEQ ID NO: 93, SEQ ID NO: 95, SEQ ID NO: 97, SEQ ID NO: 99, SEQ A fragment of a protein having an amino acid sequence of ID NO: 101, SEQ ID NO: 103, or SEQ ID NO: 109, wherein the fragment is SEQ ID NO: 2, SEQ ID NO: 4, SEQ ID NO: 6, SEQ ID NO: 8, SEQ IDNO: 10, SEQ ID NO: 12, SEQ ID NO: 14, SEQ ID NO: 16, SEQ ID NO: 18, SEQ ID NO: 20, SEQ ID NO: 22, SEQ ID NO: 24, SEQ ID NO: 26, SEQ ID NO: 28, SEQ ID NO: 30, SEQ ID NO: 32, SEQ ID NO: 34, SEQ ID NO: 36, SEQ ID NO: 38, SEQ ID NO: 40, SEQ ID NO: 49, SEQ ID NO: 51, SEQ ID NO: 53, SEQ ID NO: 55, SEQ ID NO: 57, SEQ ID NO: 59, SEQ ID NO: 70, SEQ ID NO: 72, SEQ ID NO: 76, SEQ ID NO: 78, SEQ ID NO: 81, SEQ ID NO: 83, SEQ ID NO: 85, SEQ ID NO: 87, SEQ ID NO: 89, Amino acids of SEQ ID NO: 91, SEQ ID NO: 93, SEQ ID NO: 95, SEQ ID NO: 97, SEQ ID NO: 99, SEQ ID NO: 101, SEQ ID NO: 103, or SEQ ID NO: 109 SEQ ID NO: 98936, 98937, 98938, 98939, 98940, 98941, 98942, 98943, 98944, 98945, 98946, 98947 15 or more amino acids of amino acid sequence encoded by DNA insertion sequences of plasmids deposited with ATCC as headings 98948, 98949, 98950, 98951, 98991, 98993 or 98994. (Eg, consecutive amino acids). In another embodiment, the protein, preferably the PCIP protein, comprises SEQ ID NO: 2, SEQ ID NO: 4, SEQ ID NO: 6, SEQ ID NO: 8, SEQ ID NO: 10, SEQ ID NO: 12, SEQ ID NO: 14, SEQ ID NO: 16, SEQ ID NO: 18, SEQ ID NO: 20, SEQ ID NO: 22, SEQ ID NO: 24, SEQ ID NO: 26, SEQ ID NO: 28, SEQ ID NO: 30, SEQ ID NO: 32, SEQ ID NO: 34, SEQ ID NO: 36, SEQ ID NO: 38, SEQ ID NO: 40, SEQ ID NO: 49, SEQ ID NO: 51, SEQ ID NO: 53, SEQ ID NO: 55, SEQ ID NO: 57, SEQ ID NO: 59, SEQ ID NO: 70, SEQ ID NO: 72, SEQ ID NO: 76, SEQ ID NO: 78, SEQ ID NO: 81, SEQ ID NO: 83, SEQ ID NO: 85, SEQ ID NO: 87, SEQ ID NO: 89, SEQ ID NO: 91, SEQ ID NO: 93, SEQ ID NO: 95, SEQ IDNO: 97, SEQ ID NO : 99, SEQ ID NO: 101, SEQ ID NO: 103, or SEQ ID NO: 109.
[24] In another embodiment, the present invention provides SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 5, SEQ ID NO: 7, SEQ ID NO: 9, SEQ ID NO: 11, SEQ ID NO: 13 , SEQ ID NO: 15, SEQ ID NO: 17, SEQ ID NO: 19, SEQ ID NO: 21, SEQ ID NO: 23, SEQ ID NO: 25, SEQ ID NO: 27, SEQ ID NO: 29, SEQ ID NO: 31, SEQ ID NO: 33, SEQ ID NO: 35, SEQ ID NO: 37, SEQ ID NO: 39, SEQ ID NO: 48, SEQ ID NO: 50, SEQ ID NO: 52, SEQ ID NO : 54, SEQ ID NO: 56, SEQ ID NO: 58, SEQ ID NO: 69, SEQ ID NO: 71, SEQ ID NO: 74, SEQ ID NO: 75, SEQ ID NO: 77, SEQ ID NO: 79 , SEQ ID NO: 80, SEQ ID NO: 82, SEQ ID NO: 84, SEQ ID NO: 86, SEQ ID NO: 88, SEQ ID NO: 90, SEQ ID NO: 92, SEQ ID NO: 94, SEQ At least 50%, 55%, 60%, 65%, 70%, 75% of the nucleotide sequence of ID NO: 96, SEQ ID NO: 98, SEQ ID NO: 100, or SEQ ID NO: 102 or a complementary sequence thereof , An isolated protein, preferably a PCIP protein, encoded by a nucleic acid molecule having at least 80%, 85%, 90%, 95%, 98% identical nucleotide sequence.
[25] Proteins or biologically active portions thereof of the invention can be operably linked to non-PCIP polypeptides (eg, heterologous amino acid sequences) to form fusion proteins. The invention further features antibodies such as monoclonal or polyclonal antibodies which specifically bind to the proteins of the invention, preferably PCIP proteins. In addition, the PCIP protein or biologically active portion thereof may be incorporated into a pharmaceutical composition, which may optionally include a pharmaceutically acceptable carrier.
[26] In another embodiment, the present invention is directed to a PCIP nucleic acid molecule in a biological sample by contacting the biological sample with an agent capable of detecting the PCIP nucleic acid molecule, protein or polypeptide such that the presence of the PCIP nucleic acid molecule, protein or polypeptide is detected in the biological sample. A method of detecting the presence of a protein or polypeptide is provided.
[27] In another aspect, the invention provides a method of detecting the presence of PCIP activity in a biological sample by contacting the biological sample with an agent capable of detecting an indicator of PCIP activity such that the presence of PCIP activity is detected in the biological sample. To provide.
[28] In another aspect, the present invention provides a method of modulating PCIP activity, comprising contacting a cell capable of expressing PCIP with an agent that modulates PCIP activity, such that intracellular PCIP activity is modulated. In one embodiment, the agent inhibits PCIP activity. In another embodiment, the agent stimulates PCIP activity. In one embodiment, the agent is an antibody that specifically binds to PCIP protein. In another embodiment, the agent modulates the expression of PCIP by modulating the transcription of the PCIP gene or the translation of PCIP mRNA. Also in another embodiment, the agent is a nucleic acid molecule having a nucleotide sequence that is antisense in the coding strand of the PCIP mRNA or PCIP gene.
[29] In one embodiment, the methods of the present invention are used to treat a diseased subject characterized by abnormal PCIP protein or nucleic acid expression or activity by administering to the subject an agent that is a PCIP modulator. In one embodiment, the PCIP modulator is a PCIP protein. In another embodiment, the PCIP modulator is a PCIP nucleic acid molecule. Also in another embodiment, the PCIP modulator is a peptide, peptidomimetic or other small molecule. In a preferred embodiment, the disease characterized by abnormal PCIP protein or nucleic acid expression is a CNS disease or a cardiovascular disease.
[30] The present invention also provides diagnostic assays for determining the presence of genetic changes characterized by one or more of the following: (i) abnormal modifications or mutations of genes encoding PCIP proteins, (ii) Mis-regulation (iii) Abnormal post-translational modification of the PCIP protein, wherein the wild-type form of the gene encodes a protein having PCIP activity.
[31] In another aspect, the present invention provides an indicator composition comprising a PCIP protein having PCIP activity, contacting the indicator composition with a test compound, and determining the effect of the test compound on PCIP activity in the indicator composition By identifying a compound that modulates activity, a method is provided for identifying a compound that binds to or modulates its activity.
[32] Other features and advantages of the invention will be apparent from the following detailed description, and from the claims.
[33] Brief description of the drawings
[34] 1 shows the cDNA sequence and the putative amino acid sequence of human 1v. The nucleotide sequence corresponds to nucleic acids 1 to 1463 of SEQ ID NO: 1. The amino acid sequence corresponds to amino acids 1 to 216 of SEQ ID NO: 2.
[35] 2 shows the cDNA sequence and putative amino acid sequence of rat 1v. The nucleotide sequence corresponds to nucleic acids 1 to 1856 of SEQ ID NO: 3. The amino acid sequence corresponds to amino acids 1 to 245 of SEQ ID NO: 4.
[36] 3 shows the cDNA sequence and putative amino acid sequence of mouse 1v. The nucleotide sequence corresponds to nucleic acids 1 to 1907 of SEQ ID NO: 5. The amino acid sequence corresponds to amino acids 1 to 216 of SEQ ID NO: 6.
[37] 4 shows the cDNA sequence and putative amino acid sequence of rat 1vl. The nucleotide sequence corresponds to nucleic acids 1 to 1534 of SEQ ID NO: 7. The amino acid sequence corresponds to amino acids 1 to 227 of SEQ ID NO: 8.
[38] 5 shows the cDNA sequence and putative amino acid sequence of mouse 1vl. The nucleotide sequence corresponds to nucleic acids 1 to 1540 of SEQ ID NO: 9. The amino acid sequence corresponds to amino acids 1 to 227 of SEQ ID NO: 10.
[39] 6 shows the cDNA sequence and putative amino acid sequence of partial rat 1vn. The nucleotide sequence corresponds to nucleic acids 1 to 955 of SEQ ID NO: 11. The amino acid sequence corresponds to amino acids 1 to 203 of SEQ ID NO: 12. (Full length rat 1vn sequence is shown in FIG. 63)
[40] 7 shows the cDNA sequence and putative amino acid sequence of human 9ql. The nucleotide sequence corresponds to nucleic acids 1 to 2009 of SEQ ID NO: 13. The amino acid sequence corresponds to amino acids 1 to 270 of SEQ ID NO: 14.
[41] 8 shows the cDNA sequence and putative amino acid sequence of rat 9ql. The nucleotide sequence corresponds to nucleic acids 1 to 1247 of SEQ ID NO: 15. The amino acid sequence corresponds to amino acids 1 to 257 of SEQID NO: 16.
[42] 9 shows the cDNA sequence and putative amino acid sequence of mouse 9ql. The nucleotide sequence corresponds to nucleic acids 1 to 2343 of SEQ ID NO: 17. The amino acid sequence corresponds to amino acids 1 to 270 of SEQ ID NO: 18.
[43] 10 shows the cDNA sequence and putative amino acid sequence of human 9qm. The nucleotide sequence corresponds to nucleic acids 1 to 1955 of SEQ ID NO: 19. The amino acid sequence corresponds to amino acids 1 to 252 of SEQ ID NO: 20.
[44] 11 shows the cDNA sequence and putative amino acid sequence of rat 9qm. The nucleotide sequence corresponds to nucleic acids 1 to 2300 of SEQ ID NO: 21. The amino acid sequence corresponds to amino acids 1 to 252 of SEQ ID NO: 22.
[45] 12 shows the cDNA sequence and putative amino acid sequence of human 9qs. The nucleotide sequence corresponds to nucleic acids 1 to 1859 of SEQ ID NO: 23. The amino acid sequence corresponds to amino acids 1-220 of SEQ ID NO: 24.
[46] 13 shows the cDNA sequence and putative amino acid sequence of monkey 9qs. The nucleotide sequence corresponds to nucleic acids 1 to 2191 of SEQ ID NO: 25. The amino acid sequence corresponds to amino acids 1 to 220 of SEQ ID NO: 26.
[47] 14 shows the cDNA sequence and putative amino acid sequence of rat 9qc. The nucleotide sequence corresponds to nucleic acids 1-2057 of SEQ ID NO: 27. The amino acid sequence corresponds to amino acids 1 to 252 of SEQ ID NO: 28.
[48] 15 shows the cDNA sequence and putative amino acid sequence of rat 8t. The nucleotide sequence corresponds to nucleic acids 1 to 1904 of SEQ ID NO: 29. The amino acid sequence corresponds to amino acids 1 to 225 of SEQ ID NO: 30.
[49] 16 shows the cDNA sequence and putative amino acid sequence of human p19. The nucleotide sequence corresponds to nucleic acids 1 to 619 of SEQ ID NO: 31. The amino acid sequence corresponds to amino acids 1 to 200 of SEQ ID NO: 32.
[50] 17 shows the cDNA sequence and putative amino acid sequence of rat p19. The nucleotide sequence corresponds to nucleic acids 1 to 442 of SEQ ID NO: 33. The amino acid sequence corresponds to amino acids 1 to 109 of SEQ ID NO: 34.
[51] 18 shows the cDNA sequence and putative amino acid sequence of mouse p19. The nucleotide sequence corresponds to nucleic acids 1 to 2644 of SEQ ID NO: 35. The amino acid sequence corresponds to amino acids 1 to 256 of SEQ ID NO: 36.
[52] 19 shows the cDNA sequence and putative amino acid sequence of human W28559. The nucleotide sequence corresponds to nucleic acids 1-380 of SEQ ID NO: 37. The amino acid sequence corresponds to amino acids 1 to 126 of SEQ ID NO: 38.
[53] 20 shows the cDNA sequence and putative amino acid sequence of human P193. The nucleotide sequence corresponds to nucleic acids 1 to 2176 of SEQ ID NO: 39. The amino acid sequence corresponds to amino acids 1 to 41 of SEQ ID NO: 40.
[54] 21 is a schematic representation of rat 1v, rat 9qm and mouse P19 proteins, arranged to show conserved domains between these proteins.
[55] 22 shows the genomic DNA sequence of human 9q. 22A shows exon 1 and its flanking intron sequence (SEQ ID NO: 46). 22B shows exons 2-11 and flanking intron sequences (SEQ ID NO: 47).
[56] 23 shows the cDNA sequence and putative amino acid sequence of monkey KChIP4a. The nucleotide sequence corresponds to nucleic acids 1 to 2413 of SEQ ID NO: 48. The amino acid sequence corresponds to amino acids 1 to 233 of SEQ ID NO: 49.
[57] 24 shows the cDNA sequence and putative amino acid sequence of monkey KChIP4b. The nucleotide sequence corresponds to nucleic acids 1 to 1591 of SEQ ID NO: 50. The amino acid sequence corresponds to amino acids 1 to 233 of SEQ ID NO: 51.
[58] 25 shows the alignment of KChIP4a, KChIP4b, 9q1, 1v, p19, and related human paralog (hsncspara) W28559. Amino acids identical to consensus are shaded in black and conserved amino acids are shaded in gray.
[59] 26 shows the cDNA sequence and putative amino acid sequence of rat 33b07. The nucleotide sequence corresponds to nucleic acids 1-2051 of SEQ ID NO: 52. The amino acid sequence corresponds to amino acids 1 to 407 of SEQ ID NO: 53.
[60] 27 shows the cDNA sequence and putative amino acid sequence of human 33b07. The nucleotide sequence corresponds to nucleic acids 1-4148 of SEQ ID NO: 54. The amino acid sequence corresponds to amino acids 1 to 414 of SEQ ID NO: 55.
[61] 28 shows the cDNA sequence and putative amino acid sequence of rat 1p. The nucleotide sequence corresponds to nucleic acids 1 to 2643 of SEQ ID NO: 56. The amino acid sequence corresponds to amino acids 1 to 267 of SEQID NO: 57.
[62] 29 shows the cDNA sequence and putative amino acid sequence of rat 7s. The nucleotide sequence corresponds to nucleic acids 1 to 2929 of SEQ ID NO: 58. The amino acid sequence corresponds to amino acids 1 to 270 of SEQ ID NO: 59.
[63] 30 shows the cDNA sequence and putative amino acid sequence of rat 29x. The nucleotide sequence corresponds to nucleic acids 1 to 1489 of SEQ ID NO: 60. The amino acid sequence corresponds to amino acids 1 to 351 of SEQ ID NO: 61.
[64] 31 shows the cDNA sequence of rat 25r. The nucleotide sequence corresponds to nucleic acids 1 to 1194 of SEQ ID NO: 62.
[65] 32 shows the cDNA sequence and putative amino acid sequence of rat 5p. The nucleotide sequence corresponds to nucleic acids 1 to 600 of SEQ ID NO: 63. The amino acid sequence corresponds to amino acids 1 to 95 of SEQ ID NO: 64.
[66] 33 shows the cDNA sequence and putative amino acid sequence of rat 7q. The nucleotide sequence corresponds to nucleic acids 1-639 of SEQ ID NO: 65. The amino acid sequence corresponds to amino acids 1 to 212 of SEQ ID NO: 66.
[67] 34 shows the cDNA sequence and putative amino acid sequence of rat 19r. The nucleotide sequence corresponds to nucleic acids 1 to 816 of SEQ ID NO: 67. The amino acid sequence corresponds to amino acids 1 to 271 of SEQ ID NO: 68.
[68] 35 shows the cDNA sequence and putative amino acid sequence of monkey KChIP4c. The nucleotide sequence corresponds to nucleic acids 1 to 2263 of SEQ ID NO: 69. The amino acid sequence corresponds to amino acids 1 to 229 of SEQ ID NO: 70.
[69] 36 shows the cDNA sequence and putative amino acid sequence of monkey KChIP4d. The nucleotide sequence corresponds to nucleic acids 1 to 2259 of SEQ ID NO: 71. The amino acid sequence corresponds to amino acids 1 to 250 of SEQ ID NO: 72.
[70] 37 shows the alignment of KChIP4a, KChIP4b, KChIP4c, and KChIP4d.
[71] 38 shows a graph showing current recordings from CHO cells expressing Kv4.2 in the presence or absence of KChIP2 (9ql). The cells are voltage clamped at -80 mV and gradually increase from -60 mV to +50 mV for 200 ms. Peak current amplitudes at various test voltages are shown in the right panel. 38 further shows a table showing the amplitude and kinetic effects of KChIP2 (9ql) on Kv4.2. KchIP2 expression changes peak current amplitude, recovery from inactivation and inactivation time constants, and activation V _1/2 .
[72] 39 shows a graph showing current recordings from CHO cells expressing Kv4.2 in the presence or absence of KChIP3 (p19). The cells are voltage clamped at -80 mV and gradually increase from -60 mV to +50 mV for 200 ms. Peak current amplitudes at various test voltages are shown in the right panel. 39 further shows a table showing the amplitude and kinetic effects of KChIP3 (p19) on Kv4.2. KchIP3 results in a change in peak current and recovery from deactivation and deactivation time constants.
[73] 40 shows the results of electrophysiological experiments demonstrating that co-expression of KchIP1 dramatically alters the current density and kinetics of Kv4.2 channels expressed in CHO cells.
[74] 40A shows current recordings from Kv4.2 transfected CHO cells. The current is vented by sequentially depolarizing the cells to a test potential of -60 to 50 mV at a maintenance potential of -80 mv. Current recording is leak subtraction using the p / 5 protocol. The current axis is shown the same magnitude as in (b) to emphasize the change in current amplitude. Inset-Single current recording at 50 mV on the extended current axis represents the dynamics of current activation and deactivation.
[75] 40B shows the current recording in (a) but was obtained from cells transfected with DNA for the same amount of Kv4.2 and KChIP1.
[76] 40C shows the peak current amplitude at all voltages obtained from cells transfected with Kv4.2 alone (n = 11) or cells transfected with KChIP1 (n = 9).
[77] 40D and 40E show recovery from deactivation using two pulse protocols. Kv4.2 alone (D) or Kv4.2 (E) co-expressed with KChIP1 are induced inactive using a first pulse of 50 mV, after which a second pulse at 50 mV is varied at various time points after the first pulse. Is applied from. The holding potential before and after all pulses is -80 mV.
[78] 40F shows a summary of the peak current recovery rates between pulses for Kv4.2 (n = 8) transfected cells and cells transfected with Kv4.2 and KChIP1 (n = 5). The time constant of recovery from inactivation is fitted to the one-way exponential function.
[79] FIG. 41 shows the alignment of human KChIP family members with closely related members of the recoverin family of Ca ²⁺ sensitizing proteins. (HIP: human hippocalcin, NCS1: rat nerve calcium sensor 1). Alignment was performed using the Macintosh MegAlign program (version 4.00 from DNASTAR) using the Cluster method with PAM250 residue weight table and default parameters, using BOXSHADES. By shading. Residues identical to the consensus were shaded black and conservative substitutions shaded grey. X, Y, Z and -X, -Y, -Z indicate the positions of residues responsible for binding to calcium in the EF hand.
[80] 42 shows a physical map of an IOSCA region.
[81] 43 shows an association map showing the location of h9q and the location of known markers associated with IOSCA and epilepsy.
[82] 44 depicts the cDNA sequence and putative amino acid sequence of human 1vl (KChIP11). The nucleotide sequence corresponds to nucleic acids 1 to 1477 of SEQ ID NO: 79. Alternate uppercase and lowercase letters represent individual exons. KChIP11 (KChIP1long) specific exons are the second exon in the sequence shown. The amino acid sequence corresponds to amino acids 1 to 227 of SEQ ID NO: 109.
[83] 45 shows the cDNA sequence and putative amino acid sequence of the N-terminal splice variant of human KChIP1N. The nucleotide sequence corresponds to nucleic acids 1-1639 of SEQ ID NO: 80. The amino acid sequence corresponds to amino acids 1 to 232 of SEQ ID NO: 81.
[84] 46 shows alignment of the N-terminal domains of rat and human KChIP1N, indicating that this N-terminal domain is conserved between two sequences.
[85] 47 depicts genomic DNA sequence of human KChIP2 (including KChIP2 1, m, s and N). The nucleotide sequence corresponds to nucleic acids 1 to 17,803 of SEQ ID NO: 74. Uppercase letters indicate exons and lowercase letters indicate introns.
[86] 48 depicts the cDNA sequence and putative amino acid sequence of rat KChIP2L. The nucleotide sequence corresponds to nucleic acids 1 to 1285 of SEQ ID NO: 75. The amino acid sequence corresponds to amino acids 1 to 270 of SEQ ID NO: 76.
[87] 49 shows the cDNA sequence and putative amino acid sequence of human 8t (KChIP2N). The nucleotide sequence corresponds to nucleic acids 1 to 2076 of SEQ ID NO: 77. The amino acid sequence corresponds to amino acids 1 to 225 of SEQ ID NO: 78.
[88] 50 shows alignment of the N-terminal domains of rat and human KChIP2N (8t) proteins, showing that these proteins exhibit 96.5% identity.
[89] 51 shows the cDNA sequence and putative amino acid sequence of full length human KChIP3. The nucleotide sequence corresponds to nucleic acids 1 to 2835 of SEQ ID NO: 82. The amino acid sequence corresponds to amino acids 1 to 256 of SEQ ID NO: 83. Alternate uppercase and lowercase letters represent individual exons.
[90] 52 depicts the cDNA sequence and putative amino acid sequence of rat KChIP3. The nucleotide sequence corresponds to nucleic acids 1 to 2414 of SEQ ID NO: 84. The amino acid sequence corresponds to amino acids 1 to 178 of SEQ ID NO: 85. Uppercase letters indicate coding regions, and lowercase letters indicate 3 'UTRs.
[91] Figure 53 shows the cDNA sequence and putative amino acid sequence of monkey KChIP4XC (KChIP4b). The nucleotide sequence corresponds to nucleic acids 1 to 1005 of SEQ ID NO: 86. The amino acid sequence corresponds to amino acids 1 to 127 of SEQ ID NO: 87.
[92] 54 shows the cDNA sequence and putative amino acid sequence of mouse KChIP4N2 (KChIP4c). The nucleotide sequence corresponds to nucleic acids 1 to 2181 of SEQ ID NO: 88. The amino acid sequence corresponds to amino acids 1 to 229 of SEQ ID NO: 89.
[93] 55 shows the cDNA sequence and putative amino acid sequence of rat KChIP4. The nucleotide sequence corresponds to nucleic acids 1-2022 of SEQ ID NO: 90. The amino acid sequence corresponds to amino acids 1 to 198 of SEQ ID NO: 91.
[94] FIG. 56 shows the cDNA sequence and putative amino acid sequence of human KChIP4aS (KChIP4N1S), which is the shorter splice variant of KChIP4N1. The nucleotide sequence corresponds to nucleic acids 1 to 2366 of SEQ ID NO: 92. The amino acid sequence corresponds to amino acids 1 to 188 of SEQ ID NO: 93.
[95] Figure 57 depicts cDNA sequence and putative amino acid sequence of human KChIP4a (KChIP4N1). The nucleotide sequence corresponds to nucleic acids 1 to 2431 of SEQ ID NO: 94. The amino acid sequence corresponds to amino acids 1 to 233 of SEQ ID NO: 95.
[96] 58 shows the cDNA sequence and putative amino acid sequence of human KChIP4c (KChIPN2). The nucleotide sequence corresponds to nucleic acids 1 to 2261 of SEQ ID NO: 96. The amino acid sequence corresponds to amino acids 1 to 229 of SEQ ID NO: 97.
[97] 59 shows the cDNA sequence and putative amino acid sequence of human KChIP4d (KChIP4N3). The nucleotide sequence corresponds to nucleic acids 1 to 2299 of SEQ ID NO: 98. The amino acid sequence corresponds to amino acids 1 to 250 of SEQ ID NO: 99.
[98] Figure 60 depicts the cDNA sequence and putative amino acid sequence of rat KChIP4N1x (splice variant of KChIP4N2). The nucleotide sequence corresponds to nucleic acids 1 to 2246 of SEQ ID NO: 100. The amino acid sequence corresponds to amino acids 1 to 272 of SEQ ID NO: 101.
[99] FIG. 61 is a set of graphs illustrating competitive adjustment of Kv4.3 inactivation time constants by KChIP4N2 and KChIP1. FIG. The injected cRNA species are listed in the cRNA section, with 4.3 representing Kv4.3, 1 representing KChIP1, and 4 representing KChIP4. The numbers in parentheses indicate the dilution factor of the injected cRNA, 1x is the stock. The triangle on the top of the bar graph illustrates the combined amount of KChIP4N2 or KChIP1 and the increase of KChIP1 or KChIP4N2, respectively.
[100] FIG. 62 shows protein alignment, indicating that the N-terminal domains of human KChIP1N and monkey KChIP4N2 are homologous and that the N-terminal domains of human / rat KChIP4N2 and monkey KChIP4N2 are different.
[101] 63 shows the cDNA sequence and putative amino acid sequence of rat KChIP1N (1vn). The nucleotide sequence corresponds to nucleic acids 1 to 1856 of SEQ ID NO: 102. The amino acid sequence corresponds to amino acids 1-232 of SEQ ID NO: 103.
[102] FIG. 64 is a graph depicting concentration dependent regulation of Kv4.3 and Kv4.3 / KChIP1 currents in Xenopus oocytes by arachidonic acid. Depolarized pulse from +80 mV to +40 mV at a holding potential of -80 mV (duration = 500 ms). Arachidonic acid of 1-10 μM inhibited the peak amplitude (A) in oocytes (solid line) injected with Kv4.3 cRNA itself and oocytes (dotted line) co-injected with both Kv4.3 and KChIP1 cRNA and inactivation time constant ( τ _inact ) (B) was reduced. N is 5 oocytes for each data point.
[103] FIG. 65 is a graph showing that the regulation of Kv4.3 and Kv4.3 / KChIP1 currents by arachidonic acid is reversible. The current in Xenopus oocytes was vented every 7 seconds using a depolarized pulse (duration = 500 ms) from a sustain potential of −80 mV to +40 mV. Effects on peak amplitude (A) and inactivation time constant (τ _inact ) (B) are shaded bars representing the application of 10 μM arachidonic acid and empty bars representing washing with ND96 medium supplemented with 0.5 mg / ml BSA. Is shown (n is 5 for each data point).
[104] 66 is a graph depicting the regulation of Kv4.3 and Kv4.3 / KChIP1 by fatty acids. (A) 10 μM linolelide acid (n = 9, 8 for Kv4.3, Kv4.3 / KChIP1, respectively), γ-linolenic acid (n = 9, 8), ETI (n =) in Xenopus oocytes 4, 6), blocking rates of Kv4 (empty bars) and Kv4.3 / KChIP (shaded bars) by ETYA (n = 4, 6), and arachidonic acid (n = 8,9). All values except linolelide acid / Kv4.3 alone were statistically significant compared to the nonfatty acid control. The difference in all values between Kv4.3 and Kv4.3 + KChIP1 for all fatty acids was statistically significant. (B) Inhibition rate of inactivity time constant (τ _inact ) of current in panel A under the same conditions. Values are presented as mean ± SEM. All values for Kv4.3 + KChIP except for linolelide acid were statistically significant compared to the fatty acid free control. The difference in values between Kv4.3 and Kv4.3 + KChIP1 was significant in all fatty acid treatments except linolelide acid.
[105] FIG. 67 is a graph showing that arachidonic acid does not interfere with binding between the N-terminal domain of KChIP1 and Kv4.3. FIG. (A) The superimposed sensograms show that neither the binding step nor the degradation step for the interaction between Kv4.3's intracellular N-terminal domain and KChIP1 was quantitatively altered by 10 μM arachidonic acid in the biosensor assay. Shows. (B) The N-terminal domain of Kv4.3 and KChIP1 interaction dependent growth in selective SC-WLH medium was not altered by 10 μM of ETYA. Non-selective medium SC-WL, which allows the strain to grow independently of the interaction between the N-terminal domain of Kv4.3 and KChIP1, was used to modulate the nonspecific effect of ETYA on the growth of the strain. Values are presented as mean ± SEM. N is 4 for each data point.
[106] FIG. 68 is a graph showing results from tackman analysis of rat KChIP1N tissue expression.
[107] The present invention at least partially discovers the discovery of a novel nucleic acid molecule encoding a gene product (paralog) having a substantial homology with the gene product interacting with the potassium channel protein or with the gene product of the invention interacting with the potassium channel protein. Based. Potassium channel proteins are, for example, potassium channels with Kv 4.2 or Kv 4.3 subunits. Nucleic acid molecules and gene products thereof of the present invention are referred to herein as "Potassium Channel Interacting Proteins", "PCIP" or "KChIP" nucleic acid and protein molecules. Preferably, the PCIP protein of the invention interacts with, for example binds to, potassium channel proteins, modulates the activity of potassium channel proteins, and / or modulates potassium channel mediated activity in cells, eg neurons or heart cells. Adjust
[108] As used herein, the term "PCIP family" refers to two or more proteins or nucleic acid molecules having a "PCIP" activity as defined herein when it relates to the proteins and nucleic acid molecules of the present invention. Such PCIP family members may be natural or unnatural and may be derived from the same or different species. For example, the PCIP family may contain a first protein of human origin and others, and alternatively other proteins of human origin may contain homologues of non-human origin.
[109] The terms "PCIP activity", "biological activity of PCIP" or "functional activity of PCIP", as used interchangeably herein, are defined on PCIP reactive cells or PCIP protein substrates, measured in vivo or ex vivo according to standard techniques. By activity represented by a PCIP protein, polypeptide or nucleic acid molecule. In one embodiment, the PCIP activity is direct activity, such as binding to a PCIP-target molecule. As used herein, the term “target molecule” or “binding partner” is a molecule to which a PCIP protein naturally binds or interacts so that PCIP mediated function is achieved. The PCIP target molecule can be a non-PCIP molecule or a PCIP protein or polypeptide of the invention. In an exemplary embodiment, the PCIP target molecule is a PCIP ligand. Alternatively, PCIP activity is indirect activity such as cell signaling activity mediated by the interaction of PCIP proteins with PCIP ligands. The biological activity of PCIP is described herein.
[110] For example, a PCIP protein of the invention may exhibit one or more of the following activities: (1) PCIP protein may interact with (eg, bind to) a potassium channel protein or portion thereof; (2) PCIP proteins can regulate the phosphorylation status of potassium channel proteins or portions thereof; (3) PCIP proteins can be associated with (eg, bind to) calcium, such as acting as calcium dependent kinases, eg, phosphorylating potassium channels or G protein coupled receptors in a calcium dependent manner; (4) PCIP proteins may be associated with (eg, bind to) calcium and may act, for example, in a calcium dependent manner in cellular processes, eg as calcium dependent transcription factors; (5) PCIP proteins can beneficially affect cells by regulating potassium channel mediated activity in cells (eg neuronal cells or cardiac cells such as sensory neuronal cells or motor neuron cells); (6) PCIP proteins can modulate chromatin formation in cells, eg neurons or cardiac cells; (7) PCIP proteins can regulate vesicle exchange and protein transport in cells, eg neurons or cardiac cells; (8) PCIP proteins can modulate cytokine signaling in cells, eg neurons or cardiac cells; (9) PCIP proteins can regulate the relationship between potassium channel proteins or portions thereof and cellular structure; (10) PCIP proteins can regulate cell proliferation; (11) PCIP proteins can regulate the release of neurotransmitters; (12) PCIP proteins can regulate membrane stimulation; (13) PCIP proteins can affect the residual potential of the membrane; (14) PCIP proteins can regulate the waveform and frequency of action potentials; (15) PCIP protein can regulate the threshold of stimulation.
[111] As used herein, the term "potassium channel" includes a protein or polypeptide that is involved in receiving, inducing, and delivering a signal in a stimulatory cell. Potassium channels are commonly expressed in electrically stimulable cells, such as nerves, heart, skeletal muscle, smooth muscle, kidneys, endocrine glands and oocytes, for example to form heteropolybinding structures consisting of pore formation and cytoplasmic subunits. Can be. Examples of potassium channels include (1) voltage-gated potassium channels, (2) ligand-gated potassium channels, and (3) mechanically-gated potassium channels. For a detailed description of potassium channels, see the following references cited herein by Kandel E.R. et al., Principles of Neural Science, second edition, (Elsevier Science Publishing Co., Inc., N.Y. (1985)). PCIP proteins of the invention appear to interact with potassium, for example with Kv4.3 subunits or Kv4.2 subunits.
[112] As used herein, the term “potassium channel mediated activity” refers to potassium channels, such as potassium in neuronal cells or heart cells, that are involved in receiving, inducing, and transmitting signals in potassium channels, such as the nervous or heart systems. Activity associated with the channel. Potassium channel mediated activity may include release of neurotransmitters such as dopamine or norepinephrine from cells, such as neurons or heart cells; Regulation of the resting potential of the membrane, the waveform and frequency of the action potential, and the threshold of stimulation; And regulation of processes such as, for example, the integration of conductive and subthreshold synaptic responses that reverse propagation of action potentials in neuronal cells or cardiac cells.
[113] As the PCIP protein of the invention modulates potassium channel mediated activity, this protein may be useful as a novel diagnostic and therapeutic agent for diseases associated with potassium channels and / or diseases associated with nervous system. In addition, the PCIP proteins of the invention have Kv4 potassium channels, such as Kv4.2 or Kv4.3 subunits, based on voltage-gated K + currents (known as I _to (transient external currents)) in mammalian hearts. Modulates potassium channels. See Kaab S. et al. (1998) Circulation 98 (14): 1383-93; Dixon, JE et al., (1996) Circulation Research 79 (4): 659-68; Nerbonne JM (1998) Journal of Neurobiology 37 (1): 37-59; Barry DM et al. (1998) Circulation Research 83 (5): 560-7; Barry DM et al. (1996) Annual Review of Physiology 58: 363-94. The current is based on rapid repolarization of cardiomyocytes during action potential. This current is also involved in the interval between beats by regulating the rate at which the cardiomyocytes reach their threshold for causing the accompanying action potential.
[114] This current is also known to regulate cardiac hypertrophy in the patient, prolonging the cardiac action potential. In such patients, prolonged action potentials are thought to cause changes in calcium load and calcium processing within the myocardium, contributing to the progression of heart disease from hypertrophy to heart disorders. Wickendenet al., (1998) Cardiovascular Research 37: 312]. Surprisingly, several PCIPs of the invention (eg 9ql, 9qm, 9qs set forth in SEQ ID NOs: 13, 15, 17, 19, 21, 23 and 25) contain Kv4.2 or Kv4.3 subunits. Binds to a potassium channel, modulates the potassium channel, and contains a calcium-bound EF hand domain. Due to mutations in these PCIP genes, defects in the expression of these calcium-binding PCIP proteins themselves, or defects in the interaction between these PCIPs and Kv4.2 or Kv4.3 channels, may be attributed to Kv4.3 or Kv4.3 ( I _m ) is expected to induce a decrease in current, and therapeutic agents that alter PCIP expression or modulate interactions between PCIP and Kv4.2 or Kv4.3 channels slow the progression of the disease from hypertrophy to cardiac disorders. It can be a very important therapeutic agent to inhibit.
[115] As used herein, "potassium channel related disease" includes diseases, diseases or symptoms characterized by misregulation of potassium channel mediated activity. Potassium channel related diseases include the delivery of sensory impulses from the peripheral to the brain and / or the induction of motor impulses from the brain to the peripheral; Integration of reflexes; Interpretation of sensory impulses; And emotional, intellectual (eg, learning and memory), or motor courses. Potassium channel related diseases can also adversely affect the electrical impulse that stimulates myocardial fibers to contact. Examples of potassium channel related diseases include nervous system related diseases and cardiovascular diseases.
[116] As used herein, the term "nerve related disease" includes a disease, disorder or condition affecting the nervous system. Examples of potassium channel related diseases and nervous system related diseases include cognitive disorders such as memory and learning disorders such as memory loss, motor neuron disorder, cognitive impairment, amnesia, aphasia, forgetful spatial coordination, Kluver-Kusher -Bucy syndrome, memory loss associated with Alzheimer's (Eglen RM (1996) Pharmacol. And Toxicol. 78 (2): 59-68; Perry EK (1995) Brain and Cognition 28 (3); 240-58) and inability to learn; Delerium associated with diseases affecting awareness, such as vision, perception disorders, or Lewy body dementia; Schizoaffective disease (Dean B. (1996) Mol.Psychiatry 1 (1): 54-8), schizophrenia with ups and downs (Bymaster FP (1997) J. Clin.Psychiatry 58 (suppl. 10): 28- 36; Yeomans JS (1995) Neuropharmacol. 12 (1): 3-16; Reimann D. (1994) J. Psychiatric Res. 28 (3): 195-210), depression (primary or secondary); Affective disorder (Janowsky D.S. (1994) Am. J. Med. Genetics 54 (4): 335-44); Sleep disorders (Kimura F. (1997) J. Neurophysiol. 77 (2): 709-16), eg REM sleep abnormalities in patients suffering from depression (Rieman D. (1994) J. Psychosomatic Res. 38 Suppl. 1: 15-25; Bourgin P. (1995) Neuroreport 6 (3): 532-6), paradoxical sleep disorders (Sakai K. (1997) Eur. J. Neuroscience 9 (3): 415-23), Body temperature or respiratory depression abnormalities during insomnia and sleep (Shuman SL (1995) Am. J. Physiol. 269 (2 Pt 2): R308-17; Mallick BN (1997) Brain Res. 750 (1-2): 311- 7) is included. Other examples of nervous system-related disorders include diseases affecting pain development mechanisms, such as pain associated with irritable bowel syndrome (Mitch CH (1997) J. Med. Chem. 40 (4): 538-46; Shannon HE ( 1997) J. Pharmac. And Exp. Therapeutics 281 (2): 884-94; Bouaziz H. (1995) Anesthesia and Analgesia 80 (6): 1140-4; or Guimaraes AP (1994) Brain Res. 647 (2) : 220-30) or chest pain; Exercise disorders (Monassi CR (1997) Physiol. And Behav. 62 (1): 53-9), for example Parkinson's disease-related movement disorders (Finn M. (1997) Pharmacol. Biochem & Behavior 56 (2): 273 -9); Obesity associated with food disorders, such as insulin hypersecretion (Maccario M. (1997) J. Endocrinol. Invest. 20 (1): 8-12; Premawardhana LD (1994) Clin. Endocrinol. 40 (5): 617-21 ); Drinking disorders such as diabetes mellitus (Murzi E. (1997) Brain Res. 752 (1-2): 184-8; Yang X. (1994) Pharmacol. Biochem & Behavior 49 (1): 1-6; Neurodegenerative diseases such as Alzheimer's disease, dementia associated with Alzheimer's disease (such as Pick's disease), Parkinson's and other diffuse Lewy body disease, multiple sclerosis, amyotrophic lateral sclerosis, progressive nuclear palsy, epilepsy, spinal cord brain degeneration, epilepsy syndromes and Creutzfeldt-Jakob disease; psychosis, such as depression, schizophrenia, Korsakoff's disease, manic, anxiety, bipolar emotional disorders, or phobias, neurological diseases such as migraine; spinal cord injury; seizures and head trauma.
[117] As used herein, the term “epilepsy” includes general neurological diseases caused by disorders of the normal electrical function of the brain. In normal brain function, numerous micro electric charges pass from the neuronal cells of the brain to all parts of the body. In patients with epilepsy, this normal pattern is interrupted by a sudden and unusually strong seizure of electrical energy, which may simply affect human perception, physical movement or sensation. This physical change is called an epileptic seizure. There are two categories of seizures: one is a partial seizure that occurs in one domain of the brain and the other is an integrated seizure that affects neuronal cells throughout the brain. Epilepsy may include brain damage before, during, or after birth; Head trauma; Nutritional deficiency; Some infectious diseases; Brain tumors; And some poisons. In many cases, however, the cause is unknown. The invention of epilepsy can be caused by feelings of anxiety or emotional discomfort called precursors that indicate the onset of seizures. The signs of an impending epileptic seizure varying from patient to patient may include visual phenomena such as unstable light or “intense sunshine”. Recently, genetic binding to epilepsy has been found on chromosome 10q, the neighboring marker D10S192: 10q22-q24. Ottman et al. (1995) Nature Genetics 10: 56-60. Various forms of epilepsy include grand seizures, Jackson type, myoclonic spreading family type, small seizures, Lennox-Gasutt syndrome, febrile seizures, psychomotor and transient lobes. The ones described herein are particularly useful for developing therapies for partial bran.
[118] As used herein, the term “ataxia” is a common neurological disease caused by disorders of the normal electrical function of the brain. Spinal cerebellar ataxia type 1 (SCA 1) is an autosomal dominant genetic disease genetically bound to the short arm of chromosome 6 based on binding to the human major histocompatibility complex (HLA). H. Yakura et al. . (1974) N. Engl. J. Med., 291, 154-155; and J.F. Jackson et al. (1997) N. Engl. J. Med 296, 1138-1141. SCA1 has been shown to bind tightly to marker D6S89 on the short arm of chromosome 6 against HLA. See L. P. W. Ranum et al., Am. J. Hum. Genet., 49, 31-41 (1991); and H. Y. Zoghbi et al., Am. J. Hum. Genet., 49, 23-30 (1991)]. The ones described herein are particularly useful for developing therapies for infantile onset spinocerebellar ataxia (IOSCA).
[119] As used herein, the term “cardiovascular disease” includes diseases affecting the cardiovascular system, for example the heart. Examples of cardiovascular diseases include atherosclerosis, ischemia reperfusion injury, restenosis, arterial inflammation, vascular wall remodeling, ventricular remodeling, acute ventricular pacing, coronary microembolism, tachycardia, bradycardia, pressure overload, aortic flexion, coronary aorta Ligation, Vascular Heart Disease, Atrial Fibrillation, Long-QT Syndrome, Congestive Heart Injury, Cryopathic Disorders, Laryngitis, Heart Injury, Hypertension, Atrial Fibrillation, Atrial Crib, Expanded Cardiomyopathy, Idiopathic Cardiomyopathy, Myocardial Infarction, Coronary Aortic Disease , Coronary aortic spasm, or arrhythmia. In a preferred embodiment, the cardiovascular disease is associated with abnormal I _to current.
[120] As defined herein, some components of the PCIP family may also have common structural features, such as common structural domains or motifs, or sufficient amino acid or nucleotide sequence homologs. Such PCIP family members may be natural or unnatural and may contain the same or different species. For example, the PCIP family may contain a first protein of human origin and others, and alternatively other proteins of human origin may contain homologues of non-human origin.
[121] For example, members of the PCIP family having common structural features may include one or more "calcium binding domains". The term "calcium binding domain" as used herein includes amino acid domains involved in calcium binding, for example EF hand (Baimbridge K.G. et al. (1992) TINS 15 (8): 303-308). Preferably, the calcium binding domain has a sequence substantially identical to the consensus sequence:
[122] EO ... OO ... O D KDGD G · O. E F ‥ O O (SEQ ID NO: 41)
[123] O is I, L, V or M, and "·" represents a position having no strongly preferred residues at all. Each residue recorded is present in more than 25% of the sequence and the underlined residues are present in more than 80% of the sequence. Amino acid residues 126-154 and 174-202 of human lv protein, amino acid residues 126-154 and 174-202 of rat lv protein, amino acid residues 137-165 and 185-213 of rat 1vl protein, amino acid residues 142- of rat 1vn protein 170, amino acid residues 126-154 and 174-202 of mouse 1v protein, amino acid residues 137-165 and 185-213 of mouse 1vl protein, amino acid residues 144-172, 180-208 and 228-256 of human 9ql protein, human 9qm Amino acid residues 126-154, 162-190 and 210-238 of the protein, amino acid residues 94-122, 130-158 and 178-206 of the human 9qs protein, amino acid residues 126-154, 162-190 and 210- of the 9qm protein of the rat 238, amino acid residues 131-159, 167-195 and 215-243 of rat 9ql protein, amino acid residues 126-154, 162-190 and 210-238 of rat 9qc protein, amino acid residues 99-127, 135- of rat 8t protein 163 and 183-211, amino acid residues 144-172 of mouse 9ql protein, 180-208 and 228-256, of monkey 9qs protein Amino acid residues 94-122, 130-158 and 178-206, amino acid residues 94-122, 130-158 and 178-206 of human p19 protein, amino acid residues 19-47 and 67-95 of rat p19 protein, mouse p19 protein Amino acid residues 130-158, 166-194 and 214-242 comprise a calcium binding domain (EF hand) (see FIG. 1). Amino acid residues 116-127 and 152-163 of the monkey KChIP4a and KChIP4b proteins contain calcium binding domains.
[124] In another embodiment, an isolated PCIP protein of the invention comprises an amino acid sequence of about 100-200 amino acid residues in length, preferably 150-200 amino acid sequence in length, more preferably 185 amino acid residues in sequence, Identification is based on the presence of one or more conserved carboxyl terminal domains comprising the EF hand. PCIP proteins of the invention contain at least about 70%, 71%, 74%, 75%, 76%, 80% or more identical carboxyl terminal domains to the carboxyl terminal 185 amino acid residues of rat 1v, rat 9q or mouse p19. It is preferred (see FIGS. 21, 25 and 41).
[125] In addition, members of the PCIP family having common structural features are listed in Table I and described below. Other components of the PCIP family that do not have common structural features, for example members of the PCIP family, are described in Table II and described below. The present invention provides full length human and partial length rat 33b07 clones in which proteins are encoded by these cDNAs. The present invention further provides a partial length rat 1p clone wherein the cDNA encodes a protein. In addition, the present invention provides a partial length rat 7s clone wherein the cDNA encodes a protein.
[126] The invention further provides PCIP family members representing previously identified cDNAs (29x, 25r, 5p, 7q and 19r). These cDNAs previously identified are identified as members of the PCIP family, ie molecules with PCIP activity, as described herein. Accordingly, the present invention provides methods of using these cDNAs previously identified, such as methods of using these cDNAs in screening assays, diagnostic assays, prognostic assays, and methods of treatment described herein.
[127] The PCIP molecules of the invention are based on the ability to interact with 180 amino acids of the amino terminus of the rat Kv4.3 subunit, as determined using the yeast two-hybrid assay (described in detail in Example 1). It is confirmed early. Further binding studies with other potassium subunits were performed to demonstrate the specificity of PCIP for Kv4.3 and Kv4.2. The in situ localization, immunohistochemical, co-immunoprecipitation and patch clamping methods are then used to interact with and control the activity of the PCIPs of the invention with potassium channels, particularly those containing 4.3 or 4.2 subunits. Proved.
[128] Several new human, mouse, monkey and rat PCIP family members have been identified herein as 1v, 9q, p19, W28559, KChIP4, 33b07, 1p and rat 7s protein and nucleic acid molecules. Human, rat and mouse cDNAs encoding Iv polypeptides are represented by SEQ ID NOs 1, 3 and 5, and are shown in FIGS. 1, 2 and 3, respectively. In the brain, 1v mRNA is highly expressed in the renal cortex and hippocampal intermediate neurons, in the thalamic reticulum nucleus and medial halter, in the basal forebrain and progenitor cholinergic neurons, in the upper globules, and in the cerebellar granule cells. Iv polypeptides are highly expressed at the axon and axon ends, dendritic processes, and body weight of cells expressing 1v mRNA. Splicing variants of the 1v gene are identified in rats and mice, represented by SEQ ID NOs: 7, 9 and 11, and are shown in FIGS. 4, 5 and 6, respectively. Iv polypeptides interact with potassium channels that include Kv4.3 or kv4.2 subunits and do not include Kv1.1 subunits. As determined by the Northern blot, 1v transcript (mRNA) is predominantly expressed in the brain.
[129] 8t cDNA (SEQ ID NO: 29) encodes a polypeptide having a molecular weight of about 26 kD, corresponding to SEQ ID NO: 30 (see FIG. 15). The 8t polypeptide reacts with potassium channels that include Kv4.3 or Kv4.2 subunits but do not include Kv1.1 subunits. As evidenced by northern blots and field data, 8t mRNA is predominantly expressed in the heart and brain. 8tcDNA is a 9q splicing variant.
[130] Human, rat, monkey and mouse 9q cDNAs are also isolated. Splicing variants include human 9ql (SEQ ID NO: 13; Fig. 7), rat 9ql (SEQ ID NO: 15; Fig. 8), mouse 9ql (SEQ ID NO: 17; Fig. 9), human 9qm (SEQ ID NO. : 19; FIG. 10), rat 9qm (SEQ ID NO: 21; FIG. 11), human 9qs (SEQ ID NO: 23; FIG. 12), monkey 9qs (SEQ ID NO: 25; FIG. 13), and rat 9qc ( SEQ ID NO: 27; FIG. 14). A genomic DNA sequence of 9q was also determined. Exon 1 and its flanking intron sequence (SEQ ID NO: 46) are shown in FIG. 22A. Exon 2-11 and its flanking intron sequence (SEQ ID NO: 47) are shown in FIG. 22B. The 9q polypeptide reacts with potassium channels that contain Kv4.3 or Kv4.2 subunits but do not contain Kv1.1 subunits. As evidenced by northern blots and in situ data, 9q protein is predominantly expressed in the heart and brain. In the brain, 9q mRNA is highly expressed in nematode, hippocampal formation, neocortical pyramidal cells and interneurons, thalamus, upper globules and cerebellum.
[131] Human, rat and mouse P19 cDNAs are also isolated. Human P19 is SEQ ID NO: 31 and FIG. 16; And SEQ ID NO: 39 and FIG. 20 (3 ′ sequence). Rat P19 is shown in SEQ ID NO: 33 and FIG. 17, and mouse P19 is shown in SEQ ID NO: 35 and FIG. 18. P19 polypeptides react with potassium channels that include Kv4.3 or Kv4.2 subunits but do not include Kv1.1 subunits. As evidenced by northern blots and in situ data, P19 transcripts (mRNAs) are predominantly expressed in the brain.
[132] Partial human paralogs of PCIP molecules have also been identified. This paralog is referred to as W28559 and is shown in SEQ ID NO: 37 and FIG. 19.
[133] Monkey KChIP4a and its splicing variants KChIP4b, KChIP4c and KChIP4d have also been identified. Monkey KChIP4a is shown in SEQ ID NO: 48 and FIG. 23. Monkey KChIP4b is shown in SEQ ID NO: 50 and FIG. 24. Monkey KChIP4c is shown in SEQ ID NO: 69 and FIG. 35. Monkey KChIP4d is shown in SEQ ID NO: 71 and FIG. 36.
[134] The nucleotide sequence of the full length rat 33b07 cDNA and the amino acid sequence of the rat 33b07 polypeptide are shown in FIG. 26 and SEQ ID NOs: 52 and 53, respectively. Rat 33b07 cDNA encodes a protein having a molecular weight of about 44.7 kD and a length of 407 amino acid residues. Rat 33b07 binds rKv4.3N and rKv4.2N and was slightly dominant for rKv4.2N in the yeast two-hybrid assay.
[135] The nucleotide sequence of the full length human 33b07 cDNA and the predicted amino acid sequence of the human 33b07 polypeptide are shown in FIG. 27 and SEQ ID NOs 54 and 55, respectively.
[136] The nucleotide sequence of the partial length rat 1p cDNA and the predicted amino acid sequence of the rat 1p polypeptide are shown in FIG. 28 and SEQ ID NOs 56 and 57, respectively. Rat 1p cDNA encodes a protein of about 28.6 kD molecular weight and 267 amino acid residues in length. Rat 1p binds rKv4.3N and rKv4.2N and was slightly dominant for rKv4.3N in the yeast two-hybrid assay.
[137] The nucleotide sequence of the partial length rat 7s cDNA and the predicted amino acid sequence of the rat 7s polypeptide are shown in Figure 29 and SEQ ID NOs 58 and 59, respectively. Rat 7s cDNA encodes a protein of about 28.6 kD molecular weight and 270 amino acid residues in length. Rat 7s binds rKv4.3N and rKv4.2N and was slightly predominant for rKv4.3N in the yeast two-hybrid assay.
[138] The sequences of the present invention are summarized in Tables I and II below.
[139] Table I
[140] Novel Polynucleotides and Polypeptides of the Invention (Full Length Except as Shown)
[141] PCIP Nucleic Acid Molecular Type Source SEQ ID NO: DNA SEQ ID NO: Protein ATCC 1v or KChIP1 1v Human (225-875) ^* One 2 98994 KChIP1N (1vN) N-Terminal Splicing Variants Human (353-461) 80 81 1v Rat (210-860) 3 4 98946 1v Mouse (477-1127) 5 6 98945 1v1 human 79 109 1vl Rat (31-714) 7 8 98942 1vl Mouse (77-760) 9 10 98943 1vn Rat (345-955) (339-1037) 11 (partial) 102 (full length) 12 (partial) 103 (full length) 98944 9q or KChIP2 Genomic DNA sequence human 74Genomic DNA sequence (exon 1 and flanking intron sequences) human 46Genomic DNA sequence (exon 2-11 and flanking intron sequence) human 479ql Human (207-1019) 13 14 9899398991 9ql Rat (2-775) (1-813) 15 (partial) 75 (full length) 16 (partial) 76 (full length) 98948 9ql Mouse (181-993) 17 18 98937 9qm Human (207-965) 19 20 9899398991 9qm Rat (214-972) 21 22 98941 9qs Human (207-869) 23 24 98951 9qs Monkey (133-795) 25 26 98950 9qc Rat (208-966) 27 28 98947 8t Human (1-678) 77 (partial) 78 (partial)Rat (1-678) 29 (partial) 30 (partial) 98939 p19 or KChIP3 KChIP3 (Full Length) Human (16-786) 82 83 p19 Human (1-771) 31 32 PTA-316 p19 Rat (1-330) (1-579) 33 (partial) 84 (partial) 34 (partial) 85 (partial) 98936 p19 Mouse (49-819) 35 36 98940 p193 (partial) Human (2-127) 39 40 98949 W28559 W28559 (partial) Human (1-339) 37 38 KChIP4 KChIP4a (KChIP4N1) Human (248-949) 94 95 Shorter Splicing Variants of KChIP4aS (KChIP4N1S) KChIP4N1 Human (319-885) 9269 9370
[142] KChIP4c (KChIP4N2) Human (90-779) 69 70 KChIP4d (KChIP4N3) Human (65-817) 98 99 KChIP4a (KChIP4N1) Monkey (265-966) 48 49 KChIP4bC-Terminal Splicing Variants Monkey (265-966) 50 (partial) 51 (partial) KChIP4b (KChIP4XC) Monkey (1-385) 86 (partial) 87 (partial) KChIP4c (KChIP4N2) Splicing Variants Monkey (122-811) 69 70 KChIP4d (KChIP4N3) Splicing Variants Monkey (64-816) 71 72 KChIP4c (KChIP4N2) Mouse (56-745) 88 89 KChIP4 Rat (1-597) 90 (partial) 91 (partial) Splicing variant of XKChIP4aX (KChIP4N1x) KChIP4N1 Rat (1-821) 100 (partial) 101 (partial) The coordinates of the coding sequence are given in parentheses. The first column represents the identified PCIP and column 2 represents the various nucleic acid types identified for each family.
[143] Table II
[144] Polynucleotides and Polypeptides of the Invention (full length except as indicated)
[145] PCIP Nucleic acid molecule type Source SEQ ID NO: DNA SEQ ID NO: Protein ATCC 33b07 new 33b07 Human (88-1332) 52 53 PTA-316 33b07 Rat (85-1308) 54 55 1pnew 1p (partial) Rat (1-804) 56 57 7s new 7 s (partial) Rat (1-813) 58 59 29x 29x Rat (433-1071) 60 61 25r29x Splicing Variants Rat (130-768) 62 5p 5p Rat (52-339) 63 64 7q 7q Rat (1-639) 65 66 19r 19r Rat (1-816) 67 68 The coordinates of the coding sequence are given in parentheses. The first column represents four families of identified PCIPs, and column 2 represents the various nucleic acid types identified for each family. In addition, new molecules are shown.
[146] Plasmids containing nucleotide sequences encoding PCIP of humans, rats and monkeys were deposited on November 17, 1998 in the American Type Culture Collection (ATCC), 10801 University Boulevard, Manassas, VA 20110-2209. And assigned the accession number described above. These deposits will be maintained under the Budapest Treaty, an international treaty of microbial deposits for patent procedure purposes. These deposits are merely for the convenience of those skilled in the art, and the deposits are 35 U.S.C. It is not a permit required under § 112.
[147] Clones containing cDNA molecules encoding human p19 (clone EphP19) and human 33b07 (clone Eph33b07) were deposited on July 8, 1998 as Accession No. PTA-316 to the American Type Culture Collection (Manassa, VA). , As part of a complex deposit representing a mixture of two strains, has one recombinant plasmid containing each specific cDNA clone (ATCC strain designation for a mixture of hP19 and h33b07 is EphP19h33b07mix).
[148] To distinguish and isolate strains containing specific cDNA clones, a portion of the mixture was streaked to form a single colony on an LB plate supplemented with 100 ug / ml ampicillin to grow a single colony, followed by standard mini-manufacturing methods ( minipreparation). Next, a sample of DNA minipreparation can be enzymatically digested with NotI, and the resulting product is resolved on 0.8% agarose gel using standard DNA electrophoresis conditions. Enzymes gave the following band pattern: EphP19: 7 kb 9 (single band), Eph33b07: 5.8 kb (single band).
[149] Various aspects of the invention are described in detail in the following paragraphs:
[150] I. Isolated Nucleic Acid Molecules
[151] One aspect of the invention provides amplification of a PCIP nucleic acid molecule and a nucleic acid fragment sufficient to be used as a hybridization probe to identify a PCIP protein or biologically active portion thereof, a PCIP encoding nucleic acid molecule (eg, PCIP mRNA), or It relates to an isolated nucleic acid molecule encoding a fragment for use as a PCR primer for mutation. As used herein, the term “nucleic acid molecule” includes analogs of DNA or RNA generated using DNA molecules (eg cDNA or genomic DNA) and RNA molecules (eg mRNA) and nucleotide analogues. The nucleic acid molecule may be single or double stranded, preferably double stranded DNA.
[152] An “isolated” nucleic acid molecule is one that is separated from other nucleic acid molecules present in the natural source of nucleic acid. Preferably, an “isolated” nucleic acid does not contain sequences that naturally flank the nucleic acid in the genomic DNA of the organism from which the nucleic acid is derived (ie, the sequences located at the 5 ′ and 3 ′ ends of the nucleic acid). For example, in various embodiments, an isolated PCIP nucleic acid molecule is about 5 kb, 4 kb, 3 kb, 2 kb, 1 kb, 0.5 kb of a nucleotide sequence that naturally flanks the nucleic acid molecule in the genomic DNA of the cell from which the nucleic acid is derived. It may contain less than 0.1 kb. In addition, an “isolated” nucleic acid molecule, such as a cDNA molecule, may be substantially free of culture medium or other cellular material when produced by recombinant technology, or may contain chemical precursors or other chemicals when chemically synthesized. You can't.
[153] Nucleic acid molecules of the invention, such as SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 5, SEQ ID NO: 7, SEQ ID NO: 9, SEQ ID NO: 11, SEQ ID NO: 13, SEQ ID NO: 15, SEQ ID NO: 17, SEQ ID NO: 19, SEQ ID NO: 21, SEQ ID NO: 23, SEQ ID NO: 25, SEQ ID NO: 27, SEQ ID NO: 29, SEQ ID NO : 31, SEQ ID NO: 33, SEQ ID NO: 35, SEQ ID NO: 37, SEQ ID NO: 39, SEQ ID NO: 46, SEQ ID NO: 47, SEQ ID NO: 48, SEQ ID NO: 50 , SEQ ID NO: 52, SEQ ID NO: 54, SEQ ID NO: 56, SEQ ID NO: 58, SEQ ID NO: 69, SEQ ID NO: 71, SEQ ID NO: 74, SEQ ID NO: 75, SEQ ID NO: 77, SEQ ID NO: 79, SEQ ID NO: 80, SEQ ID NO: 82, SEQ ID NO: 84, SEQ ID NO: 86, SEQ ID NO: 88, SEQ ID NO: 90, SEQ ID NO : 92, SEQ ID NO: 94, SEQ ID NO: 96, SEQ ID NO: 98, SEQ ID NO: 100, or the nucleotide sequence of SEQ ID NO: 102, Accession Nos. 98936, 98937, 98938, 98939, 98940, 98941, 98942, 98943, 98944, 98945, 98946, 98947, 98948, 98949, 98950, 98951 US Pat. No. 98991, 98993 or 98994 A nucleic acid molecule having the DNA sequence inserted portion thereof in the nucleotide sequence of the plasmid deposited with the ATCC standing may be isolated using the sequence information and standard molecular biology techniques provided herein. SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 5, SEQ ID NO: 7, SEQ ID NO: 9, SEQ ID NO: 11, SEQ ID NO: 13, SEQ ID NO: 15, SEQ ID NO: 17, SEQ ID NO: 19, SEQ ID NO: 21, SEQ ID NO: 23, SEQ ID NO: 25, SEQ ID NO: 27, SEQ ID NO: 29, SEQ ID NO: 31, SEQ ID NO: 33, SEQ ID NO: 35, SEQ ID NO: 37, SEQ ID NO: 39, SEQ ID NO: 46, SEQ ID NO: 47, SEQ ID NO: 48, SEQ ID NO: 50, SEQ ID NO: 52, SEQ ID NO: 54, SEQ ID NO: 56, SEQ ID NO: 58, SEQ ID NO: 69, SEQ ID NO: 71, SEQ ID NO: 74, SEQ ID NO: 75, SEQ ID NO: 77, SEQ ID NO: 79, SEQ ID NO: 80, SEQ ID NO: 82, SEQ ID NO: 84, SEQ ID NO: 86, SEQ ID NO: 88, SEQ ID NO: 90, SEQ ID NO: 92, SEQ ID NO: 94, SEQ ID NO: 96, SEQ ID NO: 98, nucleotide sequence of SEQ ID NO: 100 or SEQ ID NO: 102, Accession No. 98936, 98937, 98938, 98939, 98940 , 98941, 98942, 98943, 98944, 98945, 98946, 98947, 98948, 98949, 98950, 98951, 98991, 9 Plasmids deposited with ATCC as 98993 or 98994 Using some or all of the nucleic acid molecules having the nucleotide sequence of the DNA insert, the PCIP nucleic acid molecules as hybridization probes can be isolated using standard hybridization and cloning techniques (eg, Sambrook, J., Fritsh. E. F., and Maniatis, T. Molecular Cloning: A Laboratory Manual. 2nd, ed., Cold Spring Harbor Laboratory, Cold Spring Harbor Laboratory Press. Cold Spring Harbor. NY. 1989).
[154] Moreover, SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 5, SEQ ID NO: 7, SEQ ID NO: 9, SEQ ID NO: 11, SEQ ID NO: 13, SEQ ID NO: 15, SEQ ID NO: 17, SEQ ID NO: 19, SEQ ID NO: 21, SEQ ID NO: 23, SEQ ID NO: 25, SEQ ID NO: 27, SEQ ID NO: 29, SEQ ID NO: 31, SEQ ID NO: 33, SEQ ID NO: 35, SEQ ID NO: 37, SEQ ID NO: 39, SEQ ID NO: 46, SEQ ID NO: 47, SEQ ID NO: 48, SEQ ID NO: 50, SEQ ID NO: 52, SEQ ID NO: 54, SEQ ID NO: 56, SEQ ID NO: 58, SEQ ID NO: 69, SEQ ID NO: 71, SEQ ID NO: 74, SEQ ID NO: 75, SEQ ID NO: 77, SEQ ID NO: 79, SEQ ID NO: 80, SEQ ID NO: 82, SEQ ID NO: 84, SEQ ID NO: 86, SEQ ID NO: 88, SEQ ID NO: 90, SEQ ID NO: 92, SEQ ID Nucleotide sequence of NO: 94, SEQ ID NO: 96, SEQ ID NO: 98, SEQ ID NO: 100 or SEQ ID NO: 102, Accession No. 98936, 98937, 98938, 98939, 1st 98940, 98941, 98942, 98943, 98944, 98945, 98946, 98947, 98948, 98949, 98950, 98951, 98991 Deposited with ATCC as No. 98993 or 98994 Nucleic acid molecules comprising part or all of the nucleotide sequence of the DNA insertion sequence of the smid are SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 5, SEQ ID NO: 7, SEQ ID NO: 9, SEQ ID NO: 11, SEQ ID NO: 13, SEQ ID NO: 15, SEQ ID NO: 17, SEQ ID NO: 19, SEQ ID NO: 21, SEQ ID NO: 23, SEQ ID NO: 25, SEQ ID NO: 27, SEQ ID NO: 29, SEQ ID NO: 31, SEQ ID NO: 33, SEQ ID NO: 35, SEQ ID NO: 37, SEQ ID NO: 39, SEQ ID NO: 46, SEQ ID NO: 47, SEQ ID NO: 48, SEQ ID NO: 50, SEQ ID NO: 52, SEQ ID NO: 54, SEQ ID NO: 56, SEQ ID NO: 58, SEQ ID NO: 69, SEQ ID NO: 71, SEQ ID NO: 74, SEQ ID NO: 75, SEQ ID NO: 77, SEQ ID NO: 79, SEQ ID NO: 80, SEQ ID NO: 82, SEQ ID NO: 84, SEQ ID NO: 86, SEQ ID NO: Nucleotide sequence of 88, SEQ ID NO: 90, SEQ ID NO: 92, SEQ ID NO: 94, SEQ ID NO: 96, SEQ ID NO: 98, SEQ ID NO: 100, or SEQ ID NO: 102, accession no. 98936, 98937, 98938, 98939, 98940, 98941, 98942, 98943, 98944, 98945, 98946, 98947, 98948 , 98949 , Polymerase chain reaction using synthetic oligonucleotide primers designed based on the nucleotide sequence of the DNA insertion sequence of the plasmid deposited in ATCC as No. 98950, 98951, 98991, 98993 or 98994. Can be isolated by PCR).
[155] Nucleic acids of the invention can be amplified using suitable oligonucleotide primers according to cDNA, mRNA or alternatively genomic DNA and standard PCR amplification techniques. The nucleic acid thus amplified can be cloned into a suitable vector and characterized by DNA sequencing. In addition, oligonucleotides corresponding to PCIP nucleic acid sequences can be prepared by standard synthetic techniques using, for example, automated DNA synthesizers.
[156] In a preferred embodiment, the isolated nucleic acid molecules of the invention comprise SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 5, SEQ ID NO: 7, SEQ ID NO: 9, SEQ ID NO: 11, SEQ ID NO: 13, SEQ ID NO: 15, SEQ ID NO: 17, SEQ ID NO: 19, SEQ ID NO: 21, SEQ ID NO: 23, SEQ ID NO: 25, SEQ ID NO: 27, SEQ ID NO : 29, SEQ ID NO: 31, SEQ ID NO: 33, SEQ ID NO: 35, SEQ ID NO: 37, SEQ ID NO: 39, SEQ ID NO: 46, SEQ ID NO: 47, SEQ ID NO: 48 , SEQ ID NO: 50, SEQ ID NO: 52, SEQ ID NO: 54, SEQ ID NO: 56, SEQ ID NO: 58, SEQ ID NO: 69, SEQ ID NO: 71, SEQ ID NO: 74, SEQ ID NO: 75, SEQ ID NO: 77, SEQ ID NO: 79, SEQ ID NO: 80, SEQ ID NO: 82, SEQ ID NO: 84, SEQ ID NO: 86, SEQ ID NO: 88, SEQ ID NO : 90, SEQ ID NO: 92, SEQ ID NO: 94, SEQ ID NO: 96, SEQ ID NO: 98, nucleotide sequence of SEQ ID NO: 100, or SEQ ID NO: 102, Accession No. 98936, 98937 No. 98938, 98939, 98940, 98941, 98942, 98943, 98944, 98945, 98946, 98947, 98948, 98949, 98950, 98951, 98991, Of No. 98 993 or nucleotide sequence or sequences of such DNA insert sequences of the plasmids deposited with ATCC 98 994 as the call includes a portion of any sequence.
[157] In another preferred embodiment, isolated nucleic acid molecules of the invention comprise SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 5, SEQ ID NO: 7, SEQ ID NO: 9, SEQ ID NO: 11, SEQ ID NO: 13, SEQ ID NO: 15, SEQ ID NO: 17, SEQ ID NO: 19, SEQ ID NO: 21, SEQ ID NO: 23, SEQ ID NO: 25, SEQ ID NO: 27, SEQ ID NO: 29, SEQ ID NO: 31, SEQ ID NO: 33, SEQ ID NO: 35, SEQ ID NO: 37, SEQ ID NO: 39, SEQ ID NO: 46, SEQ ID NO: 47, SEQ ID NO: 48, SEQ ID NO: 50, SEQ ID NO: 52, SEQ ID NO: 54, SEQ ID NO: 56, SEQ ID NO: 58, SEQ ID NO: 69, SEQ ID NO: 71, SEQ ID NO: 74, SEQ ID NO: 75, SEQ ID NO: 77, SEQ ID NO: 79, SEQ ID NO: 80, SEQ ID NO: 82, SEQ ID NO: 84, SEQ ID NO: 86, SEQ ID NO: 88, SEQ ID Nucleotide sequence of NO: 90, SEQ ID NO: 92, SEQ ID NO: 94, SEQ ID NO: 96, SEQ ID NO: 98, SEQ ID NO: 100, or SEQ ID NO: 102, Accession No. 98936, first 98937, 98938, 98939, 98940, 98941, 98942, 98943, 98944, 98945, 98946, 98947, 98948, 98949 , 98950, 98951, 98991 No. 98993 or 98994, which comprises a complementary sequence of the nucleotide sequence of a DNA insertion of a plasmid deposited with ATCC or a portion of any sequence thereof. SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 5, SEQ ID NO: 7, SEQ ID NO: 9, SEQ ID NO: 11, SEQ ID NO: 13, SEQ ID NO: 15, SEQ ID NO: 17, SEQ ID NO: 19, SEQ ID NO: 21, SEQ ID NO: 23, SEQ ID NO: 25, SEQ ID NO: 27, SEQ ID NO: 29, SEQ ID NO: 31, SEQ ID NO: 33, SEQ ID NO: 35, SEQ ID NO: 37, SEQ ID NO: 39, SEQ ID NO: 46, SEQ ID NO: 47, SEQ ID NO: 48, SEQ ID NO: 50, SEQ ID NO: 52, SEQ ID NO: 54, SEQ ID NO: 56, SEQ ID NO: 58, SEQ ID NO: 69, SEQ ID NO: 71, SEQ ID NO: 74, SEQ ID NO: 75, SEQ ID NO: 77, SEQ ID NO: 79, SEQ ID NO: 80, SEQ ID NO: 82, SEQ ID NO: 84, SEQ ID NO: 86, SEQ ID NO: 88, SEQ ID NO: 90, SEQ ID NO: 92, SEQ ID NO: 94, SEQ ID NO: 96, SEQ ID NO: 98, nucleotide sequence of SEQ ID NO: 100 or SEQ ID NO: 102, Accession No. 98936, 98937, 98938, 98939, 98940 , 98941, 98942, 98943, 98944, 98945, 98946, 98947, 98948, 98949, 98950, 98951, 98991, 9 Plasmids deposited with ATCC as 98993 or 98994 Nucleic acid molecules complementary to the nucleotide sequence of the DNA insert sequence of SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 6, SEQ ID NO: 7, nucleotide of SEQ ID NO: 9 SEQ ID NO: 98936, 98937, 98938, 98939, 98940, 98941, 98942, 98943, 98944, 98945, 98946, 98947 No. 98948, 98949, 98950, 98951, 98991, 98993 or 98994 are nucleic acid molecules which are sufficiently complementary to the nucleotide sequence of the DNA insert of the plasmid deposited in the ATCC, SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 5, SEQ ID NO: 7, SEQ ID NO: 9, SEQ ID NO: 11, SEQ ID NO: 13, SEQ ID NO: 15, SEQ ID NO: 17, SEQ ID NO: 19, SEQ ID NO: 21, SEQ ID NO: 23, SEQ ID NO: 25, SEQ ID NO: 27, SEQ ID NO: 29, SEQ ID NO: 31, SEQ ID NO: 33, SEQ ID NO: 35, SEQ ID NO: 37, SEQ ID NO: 39, SEQ ID NO: 46, SEQ ID NO: 47, SEQ ID NO: 48, SEQ ID NO: 50, SEQ ID NO: 52, SEQ ID NO: 54, SEQ ID NO: 56, SEQ I D NO: 58, SEQ ID NO: 69, SEQ ID NO: 71, SEQ ID NO: 74, SEQ ID NO: 75, SEQ ID NO: 77, SEQ ID NO: 79, SEQ ID NO: 80, SEQ ID NO : 82, SEQ ID NO: 84, SEQ ID NO: 86, SEQ ID NO: 88, SEQ ID NO: 90, SEQ ID NO: 92, SEQ ID NO: 94, SEQ ID NO: 96, SEQ ID NO: 98 Nucleotide sequence of SEQ ID NO: 100 or SEQ ID NO: 102, accession nos. 98936, 98937, 98938, 98939, 98940, 98941, 98942, 98943, 98944, 98945, 98946, 98947, 98948, 98949, 98950, 98951, 98991, 98993, 98994 or PTA-316 to the ATCC. Hybridization to the nucleotide sequence of the DNA insert of the deposited plasmid forms a stable duplex.
[158] In another preferred embodiment, the isolated nucleic acid molecules of the invention comprise SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 5, SEQ ID NO: 7, SEQ ID NO: 9, SEQ ID NO: 11 , SEQ ID NO: 13, SEQ ID NO: 15, SEQ ID NO: 17, SEQ ID NO: 19, SEQ ID NO: 21, SEQ ID NO: 23, SEQ ID NO: 25, SEQ ID NO: 27, SEQ ID NO: 29, SEQ ID NO: 31, SEQ ID NO: 33, SEQ ID NO: 35, SEQ ID NO: 37, SEQ ID NO: 39, SEQ ID NO: 46, SEQ ID NO: 47, SEQ ID NO: 48, SEQ ID NO: 50, SEQ ID NO: 52, SEQ ID NO: 54, SEQ ID NO: 56, SEQ ID NO: 58, SEQ ID NO: 69, SEQ ID NO: 71, SEQ ID NO: 74, SEQ ID NO: 75, SEQ ID NO: 77, SEQ ID NO: 79, SEQ ID NO: 80, SEQ ID NO: 82, SEQ ID NO: 84, SEQ ID NO: 86, SEQ ID NO: 88, SEQ ID Full length or accession no. 98936 of NO: 90, SEQ ID NO: 92, SEQ ID NO: 94, SEQ ID NO: 96, SEQ ID NO: 98, SEQ ID NO: 100, or the nucleotide sequence of SEQ ID NO: 102 No. 98937, 98938, 98939, 98940, 98941, 98942, 98943, 98944, 98945, 98946, 98947, 98948, 98949, 98950, At least about 50%, 55%, 60%, at least part of the full length of the nucleotide sequence of the DNA insert of the plasmid deposited with the ATCC as 98951, 98991, 98993 or 98994, or any of these nucleotide sequences, At least 65%, 70%, 75%, 80%, 85%, 90%, 95%, 98% identical nucleotide sequences.
[159] In addition, the nucleic acid molecules of the present invention are SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 5, SEQ ID NO: 7, SEQ ID NO: 9, SEQ ID NO: 11, SEQ ID NO: 13, SEQ ID NO: 15, SEQ ID NO: 17, SEQ ID NO: 19, SEQ ID NO: 21, SEQ ID NO: 23, SEQ ID NO: 25, SEQ ID NO: 27, SEQ ID NO: 29, SEQ ID NO: 31, SEQ ID NO: 33, SEQ ID NO: 35, SEQ ID NO: 37, SEQ ID NO: 39, SEQ ID NO: 46, SEQ ID NO: 47, SEQ ID NO: 48, SEQ ID NO: 50, SEQ ID NO: 52, SEQ ID NO: 54, SEQ ID NO: 56, SEQ ID NO: 58, SEQ ID NO: 69, SEQ ID NO: 71, SEQ ID NO: 74, SEQ ID NO: 75, SEQ ID NO: 77, SEQ ID NO: 79, SEQ ID NO: 80, SEQ ID NO: 82, SEQ ID NO: 84, SEQ ID NO: 86, SEQ ID NO: 88, SEQ ID NO: 90, SEQ ID Nucleotide sequence of SEQ ID NO: 92, SEQ ID NO: 94, SEQ ID NO: 96, SEQ ID NO: 98, SEQ ID NO: 100 or SEQ ID NO: 102, or Accession Nos. 98936, 98937, 98938 , 98939, 98940, 98941, 98942, 98943, 98944, 98945, 98946, 98947, 98948, 98949, 98950, 98951, 98991, 98993, or 9899 As No. 4 may comprise only a portion of the nucleotide sequence of the DNA insert of the plasmid deposited in the ATCC, such as a fragment that encodes a biologically active portion of a PCIP protein, which may be used as a primer or probe. The nucleotide sequence determined from cloning of the PICP gene enables the generation of probes and primers designed for use in identifying and / or cloning PCIP analogs from other species, as well as other PCIP family members.
[160] Probes / primers typically comprise substantially purified oligonucleotides. Oligonucleotides are typically under severe conditions under SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 5, SEQ ID NO: 7, SEQ ID NO: 9, SEQ ID NO: 11, SEQ ID NO: 13, SEQ ID NO: 15, SEQ ID NO: 17, SEQ ID NO: 19, SEQ ID NO: 21, SEQ ID NO: 23, SEQ ID NO: 25, SEQ ID NO: 27, SEQ ID NO: 29, SEQ ID NO: 31, SEQ ID NO: 33, SEQ ID NO: 35, SEQ ID NO: 37, SEQ ID NO: 39, SEQ ID NO: 46, SEQ ID NO: 47, SEQ ID NO: 48, SEQ ID NO: 50, SEQ ID NO: 52, SEQ ID NO: 54, SEQ ID NO: 56, SEQ ID NO: 58, SEQ ID NO: 69, SEQ ID NO: 71, SEQ ID NO: 74, SEQ ID NO: 75, SEQ ID NO: 77, SEQ ID NO: 79, SEQ ID NO: 80, SEQ ID NO: 82, SEQ ID NO: 84, SEQ ID NO: 86, SEQ ID NO: 88, SEQ ID NO: 90, SEQ ID Nucleotide sequence of SEQ ID NO: 92, SEQ ID NO: 94, SEQ ID NO: 96, SEQ ID NO: 98, SEQ ID NO: 100, or SEQ ID NO: 102 or Accession Nos. 98936, 98937, 98938 , 98939, 98940, 98941, 98942, 98943, 98944, 98945, 98946, 98947, 98948, 98949, 98950, 98951, 9899 Sense sequence of the nucleotide sequence of the DNA insertion sequence of the plasmid deposited with ATCC as No. 1, 98993 or 98994, SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 5, SEQ ID NO: 7 , SEQ ID NO: 9, SEQ ID NO: 11, SEQ ID NO: 13, SEQ ID NO: 15, SEQ ID NO: 17, SEQ ID NO: 19, SEQ ID NO: 21, SEQ ID NO: 23, SEQ ID NO: 25, SEQ ID NO: 27, SEQ ID NO: 29, SEQ ID NO: 31, SEQ ID NO: 33, SEQ ID NO: 35, SEQ ID NO: 37, SEQ ID NO: 39, SEQ ID NO : 46, SEQ ID NO: 47, SEQ ID NO: 48, SEQ ID NO: 50, SEQ ID NO: 52, SEQ ID NO: 54, SEQ ID NO: 56, SEQ ID NO: 58, SEQ ID NO: 69 , SEQ ID NO: 71, SEQ ID NO: 74, SEQ ID NO: 75, SEQ ID NO: 77, SEQ ID NO: 79, SEQ ID NO: 80, SEQ ID NO: 82, SEQ ID NO: 84, SEQ ID NO: 86, SEQ ID NO: 88, SEQ ID NO: 90, SEQ ID NO: 92, SEQ ID NO: 94, SEQ ID NO: 96, SEQ ID NO: 98, SEQ ID NO: 100, or SEQ ID NO Nucleotide sequence of No. 102 or Accession Nos. 98936, 98937, 98938, 98939, 98940, 98941, 98942, 98943, 98944, 98945, 98946 No. Antisense sequence or SEQ ID of the nucleotide sequence of the DNA insertion sequence of the plasmid deposited in the ATCC as 98947, 98948, 98949, 98950, 98951, 98991, 98993 or 98994. NO: 1, SEQ ID NO: 3, SEQ ID NO: 5, SEQ ID NO: 7, SEQ ID NO: 9, SEQ ID NO: 11, SEQ ID NO: 13, SEQ ID NO: 15, SEQ ID NO: 17, SEQ ID NO: 19, SEQ ID NO: 21, SEQ ID NO: 23, SEQ ID NO: 25, SEQ ID NO: 27, SEQ ID NO: 29, SEQ ID NO: 31, SEQ ID NO: 33, SEQ ID NO: 35, SEQ ID NO: 37, SEQ ID NO: 39, SEQ ID NO: 46, SEQ ID NO: 47, SEQ ID NO: 48, SEQ ID NO: 50, SEQ ID NO: 52, SEQ ID NO: 54, SEQ ID NO: 56, SEQ ID NO: 58, SEQ ID NO: 69, SEQ ID NO: 71, SEQ ID NO: 74, SEQ ID NO: 75, SEQ ID NO: 77, SEQ ID NO: 79, SEQ ID NO: 80, SEQ ID NO: 82, SEQ ID NO: 84, SEQ ID NO: 86, SEQ ID NO: 88, SEQ ID NO: 90, SEQ ID NO: 92, SEQ ID NO: 94, Nucleotide sequence of SEQ ID NO: 96, SEQ ID NO: 98, SEQ ID NO: 100 or SEQ ID NO: 102 or Accession No. 98936, 98937, 98938, 98939, 98940, 98941, 98942, 98943, 98944, 98945, 98946, 98947, 98948, 98949, 98950, 98951, 98991, 98993 Or at least about 12 or 15, preferably about 20 to 25, more preferably about 30, 35, 40 of the native allelic variant or mutant of the nucleotide sequence of the DNA insertion of the plasmid deposited with ATCC as 98994 , Nucleotide sequence region that hybridizes to 45, 50, 55, 60, 65, or 75 consecutive nucleotides. In an exemplary embodiment, the nucleic acid molecules of the invention are 350-400, 400-450, 450-500, 500-550, 550-600, 600-650, 650-700, 700-750, 750-800, 800- SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 5, SEQ ID NO: comprising a nucleotide sequence of 850, 850-900, 949, 950-1000 or longer nucleotides and under stringent hybridization conditions : 7, SEQ ID NO: 9, SEQ ID NO: 11, SEQ ID NO: 13, SEQ ID NO: 15, SEQ ID NO: 17, SEQ ID NO: 19, SEQ ID NO: 21, SEQ ID NO: 23 , SEQ ID NO: 25, SEQ ID NO: 27, SEQ ID NO: 29, SEQ ID NO: 31, SEQ ID NO: 33, SEQ ID NO: 35, SEQ ID NO: 37, SEQ ID NO: 39, SEQ ID NO: 46, SEQ ID NO: 47, SEQ ID NO: 48, SEQ ID NO: 50, SEQ ID NO: 52, SEQ ID NO: 54, SEQ ID NO: 56, SEQ ID NO: 58, SEQ ID NO : 69 or SEQ ID NO: 71, SEQ ID NO: 74, SEQ ID NO: 75, SEQ ID NO: 77, SEQ ID NO: 79, SEQ ID NO: 80, SEQ ID NO: 82, SEQ ID NO: 84 , SEQ ID NO: 86, SEQ ID NO: 88, SEQ ID NO: 90, SEQ ID NO: 92, SEQ ID NO: 94, SEQ ID NO: 96, SEQ ID NO: 98, SEQ ID NO: 100 or SEQ Nucleotide sequence of ID NO: 102, or Table No. 98936, 98937, 98938, 98939, 98940, 98941, 98942, 98943, 98944, 98945, 98946, 98947, Nos. 98948, 98949, 98950, 98951, 98991, 98993 or 98994 hybridize to nucleic acid molecules of the nucleotide sequence of the DNA insertion sequence of the plasmid deposited in the ATCC.
[161] Probes based on PCIP nucleotide sequences can be used to detect transcript or genomic sequences encoding proteins that are identical or homologous. In a preferred embodiment, the probe further comprises an attached label group, such as the label group can be a radioisotope, fluorescent compound, enzyme, or enzyme carrier. Such probes misrepresent PCIP proteins by measuring levels of PCIP encoding nucleic acid in a cell sample from an individual, such as detecting whether a genomic PCIP gene may be mutated or deleted, or detecting PCIP mRNA levels. It can be used as part of a diagnostic test kit for identifying cells or tissues.
[162] Nucleic acid fragments encoding “biologically active portion of the PCIP protein” include SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 5, SEQ ID NO: 7, SEQ ID NO: 9, SEQ ID NO: 11, SEQID NO: 13, SEQ ID NO: 15, SEQ ID NO: 17, SEQ ID NO: 19, SEQ ID NO: 21, SEQ ID NO: 23, SEQ ID NO: 25, SEQ ID NO: 27, SEQ ID NO : 29, SEQ ID NO: 31, SEQ ID NO: 33, SEQ ID NO: 35, SEQ ID NO: 37, SEQ ID NO: 39, SEQ ID NO: 46, SEQ ID NO: 47, SEQ ID NO: 48 , SEQ ID NO: 50, SEQ ID NO: 52, SEQ ID NO: 54, SEQ ID NO: 56, SEQ ID NO: 58, SEQ ID NO: 69, SEQ ID NO: 71, SEQ ID NO: 74, SEQ ID NO: 75, SEQ ID NO: 77, SEQ ID NO: 79, SEQ ID NO: 80, SEQ ID NO: 82, SEQ ID NO: 84, SEQ ID NO: 86, SEQ ID NO: 88, SEQ ID NO : 90, SEQ ID NO: 92, SEQ ID NO: 94, SEQ ID NO: 96, SEQ ID NO: 98, nucleotide sequence of SEQ ID NO: 100, or SEQ ID NO: 102, or Accession No. 98936, 98937 No. 98938, 98939, 98940, 98941, 98942, 98943, 98944, 98945, 98946, 98947, 98948, 98949, No. 98950, 98951 , 98991, 98993 or 98994 can be prepared by isolating a portion of the nucleotide sequence of the DNA insertion sequence of the plasmid deposited with the ATCC, which is encoded (eg by in vitro recombinant expression) of the encoding of the PCIP protein The polypeptide is expressed and the polypeptide having PICP biological activity (the biological activity of the PCIP protein is described herein) is encoded while measuring the activity of the encoding portion of the PCIP protein.
[163] The present invention, due to the degeneracy of the genetic code, SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 5, SEQ ID NO: 7, SEQ ID NO: 9, SEQ ID NO: 11, SEQ ID NO : 13, SEQ ID NO: 15, SEQ ID NO: 17, SEQ ID NO: 19, SEQ ID NO: 21, SEQ ID NO: 23, SEQ ID NO: 25, SEQ ID NO: 27, SEQ ID NO: 29 , SEQ ID NO: 31, SEQ ID NO: 33, SEQ ID NO: 35, SEQ ID NO: 37, SEQ ID NO: 39, SEQ ID NO: 46, SEQ ID NO: 47, SEQ ID NO: 48, SEQ ID NO: 50, SEQ ID NO: 52, SEQ ID NO: 54, SEQ ID NO: 56, SEQ ID NO: 58, SEQ ID NO: 69, SEQ ID NO: 71, SEQ ID NO: 74, SEQ ID NO : 75, SEQ ID NO: 77, SEQ ID NO: 79, SEQ ID NO: 80, SEQ ID NO: 82, SEQ ID NO: 84, SEQ ID NO: 86, SEQ ID NO: 88, SEQ ID NO: 90 Nucleotide sequence represented by SEQ ID NO: 92, SEQ ID NO: 94, SEQ ID NO: 96, SEQ ID NO: 98, SEQ ID NO: 100 or SEQ ID NO: 102, or Accession No. 98936, 98937. , 98938, 98939, 98940, 98941, 98942, 98943, 98944, 98945, 98946, 98947, 98948, 98949, 98. 98950, 98951, 98991, By further comprising a nucleotide sequence of the DNA insertion sequence of the plasmid deposited as 98993 or 98994, and other nucleic acid molecules, SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 5, SEQ ID NO: 7 , SEQ ID NO: 9, SEQ ID NO: 11, SEQ ID NO: 13, SEQ ID NO: 15, SEQ ID NO: 17, SEQ ID NO: 19, SEQ ID NO: 21, SEQ ID NO: 23, SEQ ID NO: 25, SEQ ID NO: 27, SEQ ID NO: 29, SEQ ID NO: 31, SEQ ID NO: 33, SEQ ID NO: 35, SEQ ID NO: 37, SEQ ID NO: 39, SEQ ID NO : 46, SEQ ID NO: 47, SEQ ID NO: 48, SEQ ID NO: 50, SEQ ID NO: 52, SEQ ID NO: 54, SEQ ID NO: 56, SEQ ID NO: 58, SEQ ID NO: 69 , SEQ ID NO: 71, SEQ ID NO: 74, SEQ ID NO: 75, SEQ ID NO: 77, SEQ ID NO: 79, SEQ ID NO: 80, SEQ ID NO: 82, SEQ ID NO: 84, SEQ ID NO: 86, SEQ ID NO: 88, SEQ ID NO: 90, SEQ ID NO: 92, SEQ ID NO: 94, SEQ ID NO: 96, SEQ ID NO: 98, SEQ ID NO: 100, or SEQ ID NO Nucleotide sequence of No. 102 or Accession Nos. 98936, 98937, 98938, 98939, 98940, 98941, 98942, 98943, 98944, 98945 Nucleotide sequence of the DNA insertion sequence of the plasmid deposited in ATCC as No. 98946, 98947, 98948, 98949, 98950, 98951, 98991, 98993 or 98994. Encodes the same PCIP protein as encoded by. In another embodiment, an isolated nucleic acid molecule of the invention is SEQ ID NO: 2, SEQ ID NO: 4, SEQ ID NO: 6, SEQ ID NO: 8, SEQ ID NO: 10, SEQ ID NO: 12, SEQ ID NO: 14, SEQ ID NO: 16, SEQ ID NO: 18, SEQ ID NO: 20, SEQ ID NO: 22, SEQ ID NO: 24, SEQ ID NO: 26, SEQ ID NO: 28, SEQ ID NO : 30, SEQ ID NO: 32, SEQ ID NO: 34, SEQ ID NO: 36, SEQ ID NO: 38, SEQ ID NO: 40, SEQ ID NO: 49, SEQ ID NO: 51, SEQ ID NO: 53 , SEQ ID NO: 55, SEQ ID NO: 57, SEQ ID NO: 59, SEQ ID NO: 70, SEQ ID NO: 76, SEQ ID NO: 78, SEQ ID NO: 81, SEQ ID NO: 83, SEQ ID NO: 85, SEQ ID NO: 87, SEQ ID NO: 89, SEQ ID NO: 91, SEQ ID NO: 93, SEQ ID NO: 95, SEQ ID NO: 97, SEQ ID NO: 99, SEQ ID NO : 101, has a nucleotide sequence encoding a protein having an amino acid sequence of SEQ ID NO: 103 or SEQ ID NO: 109.
[164] SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 5, SEQ ID NO: 7, SEQ ID NO: 9, SEQ ID NO: 11, SEQ ID NO: 13, SEQ ID NO: 15, SEQ ID NO: 17, SEQ ID NO: 19, SEQ ID NO: 21, SEQ ID NO: 23, SEQ ID NO: 25, SEQ ID NO: 27, SEQ ID NO: 29, SEQ ID NO: 31, SEQ ID NO: 33, SEQ ID NO: 35, SEQ ID NO: 37, SEQ ID NO: 39, SEQ ID NO: 46, SEQ ID NO: 47, SEQ ID NO: 48, SEQ ID NO: 50, SEQ ID NO: 52, SEQ ID NO: 54, SEQ ID NO: 56, SEQ ID NO: 58, SEQ ID NO: 69, SEQ ID NO: 71, SEQ ID NO: 74, SEQ ID NO: 75, SEQ ID NO: 77, SEQ ID NO: 79, SEQ ID NO: 80, SEQ ID NO: 82, SEQ ID NO: 84, SEQ ID NO: 86, SEQ IDNO: 88, SEQ ID NO: 90, SEQ ID NO: 92, SEQ ID NO: 94 Nucleotide sequence represented by SEQ ID NO: 96, SEQ ID NO: 98, SEQ ID NO: 100 or SEQ ID NO: 102 or Accession Nos. 98936, 98937, 98938, 98939, 98940 , 98941, 98942, 98943, 98944, 98945, 98946, 98947, 98948, 98949, 98950, 98951, 98991, 9 Deposited with ATCC as 98993 or 98994; It will be appreciated by those skilled in the art that in addition to the nucleotide sequence of the DNA insert of the plasmid, DNA sequence polymorphisms that change the amino acid sequence of the PCIP protein may exist in the population (eg, the human population) (eg, the human population). . Such gene polymorphisms in the PCIP gene may exist individually in a population due to natural allelic modifications. As used herein, the terms “gene” and “recombinant gene” include an open reading frame that encodes a PCIP protein, preferably a mammalian PCIP protein, and may further comprise non-coding regulatory sequences and introns. Refers to a nucleic acid molecule that is present.
[165] Allelic variants of human PCIP include both functional and nonfunctional PCIP proteins. Functional allelic variants are natural amino acid sequence variants of human PCIP proteins that possess the ability to bind PCIP ligands and / or modulate any PCIP activity described herein. Functional allelic variants are typically SEQ ID NO: 2, SEQ ID NO: 4, SEQ ID NO: 6, SEQ ID NO: 8, SEQ ID NO: 10, SEQ ID NO: 12, SEQ ID NO: 14, SEQ ID NO: 16, SEQ ID NO: 18, SEQ ID NO: 20, SEQ ID NO: 22, SEQ ID NO: 24, SEQ ID NO: 26, SEQ ID NO: 28, SEQ ID NO: 30, SEQ ID NO : 32, SEQ ID NO: 34, SEQ ID NO: 36, SEQ ID NO: 38, SEQ ID NO: 40, SEQ ID NO: 49, SEQ ID NO: 51, SEQ ID NO: 53, SEQ ID NO: 55, SEQ ID NO: 57, SEQ ID NO: 59, SEQ ID NO: 70, SEQ ID NO: 72, SEQ ID NO: 76, SEQ ID NO: 78, SEQ ID NO: 81, SEQ ID NO: 83, SEQ ID NO: 85, SEQ ID NO: 87, SEQ ID NO: 89, SEQ ID NO: 91, SEQ ID NO: 93, SEQ ID NO: 95, SEQ ID NO: 97, SEQ ID NO: 101, SEQ ID NO: Conservative substitution of one or more amino acids of 103 or SEQ ID NO: 109, substitution, deletion or insertion of non-critical residues in the non-critical region of a protein will typically.
[166] Nonfunctional allelic variants are naturally occurring amino acid sequence variants of human PCIP proteins that are incapable of binding to PCIP ligands and / or modulating any PCIP activity described herein. Nonfunctional allelic variants include SEQ ID NO: 2, SEQ ID NO: 4, SEQ ID NO: 6, SEQ ID NO: 8, SEQ ID NO: 10, SEQ ID NO: 12, SEQ ID NO: 14, SEQ ID NO: 16, SEQ ID NO: 18, SEQ ID NO: 20, SEQ ID NO: 22, SEQ ID NO: 24, SEQ ID NO: 26, SEQ ID NO: 28, SEQ ID NO: 30, SEQ ID NO: 32, SEQ ID NO: 34, SEQ ID NO: 36, SEQ ID NO: 38, SEQ ID NO: 40, SEQ ID NO: 49, SEQ ID NO: 51, SEQ ID NO: 53, SEQ ID NO: 55, SEQ ID NO: 57, SEQ ID NO: 59, SEQ ID NO: 70, SEQ ID NO: 72, SEQ ID NO: 76, SEQ ID NO: 78, SEQ ID NO: 81, SEQ ID NO: 83, SEQ ID NO: 85, SEQ ID NO: 87, SEQ ID NO: 89, SEQ ID NO: 91, SEQ ID NO: 93, SEQ ID NO: 95, SEQ ID NO: 97, SEQ ID NO: 99, SEQ ID NO: 101, will typically contain non-conservative substitutions, deletions or insertions or premature cleavage of the amino acid sequence of SEQ ID NO: 103 or SEQ ID NO: 109, or substitutions, insertions or deletions in critical residues or critical regions.
[167] The invention further provides non-human orthologues of human PCIP proteins. Orthologs of human PCIP proteins are proteins isolated from nonhuman organisms and have the same PCIP ligand binding and / or regulation of potassium channel mediated activity of human PCIP proteins. Orthologs of human PCIP proteins include SEQ ID NO: 2, SEQ ID NO: 4, SEQ ID NO: 6, SEQ ID NO: 8, SEQ ID NO: 10, SEQ ID NO: 12, SEQ ID NO: 14, SEQ ID NO: 16, SEQ ID NO: 18, SEQ ID NO: 20, SEQ ID NO: 22, SEQ ID NO: 24, SEQ ID NO: 26, SEQ ID NO: 28, SEQ ID NO: 30, SEQ ID NO: 32, SEQ ID NO: 34, SEQ ID NO: 36, SEQ ID NO: 38, SEQ ID NO: 40, SEQ ID NO: 49, SEQ ID NO: 51, SEQ ID NO: 53, SEQ ID NO: 55, SEQ ID NO: 57, SEQ ID NO: 59, SEQ ID NO: 70, SEQ ID NO: 72, SEQ ID NO: 76, SEQ ID NO: 78, SEQ ID NO: 81, SEQ ID NO: 83, SEQ ID NO: 85, SEQ ID NO: 87, SEQ ID NO: 89, SEQ ID NO: 91, SEQ ID NO: 93, SEQ ID NO: 95, SEQ ID NO: 97, SEQ ID NO: 99, SEQ ID It can be readily identified as comprising an amino acid sequence substantially identical to NO: 101, SEQ ID NO: 103 or SEQ ID NO: 109.
[168] In addition, PCIP family members are encoded by SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 5, SEQ ID NO: 7, SEQ ID NO: 9, SEQ ID NO: 11, SEQ ID NO: 13, SEQ ID NO: 15, SEQ ID NO: 17, SEQ ID NO: 19, SEQ ID NO: 21, SEQ ID NO: 23, SEQ ID NO: 25, SEQ ID NO: 27, SEQ ID NO: 29, SEQ ID NO: 31, SEQ ID NO: 33, SEQ ID NO: 35, SEQ ID NO: 37, SEQ ID NO: 39, SEQ ID NO: 46, SEQ ID NO: 47, SEQ ID NO: 48, SEQ ID NO: 50, SEQ ID NO: 52, SEQ ID NO: 54, SEQ ID NO: 56, SEQ ID NO: 58, SEQ ID NO: 69, SEQ ID NO: 71, SEQ ID NO: 74, SEQ ID NO: 75, SEQ ID NO: 77, SEQ ID NO: 79, SEQ ID NO: 80, SEQ ID NO: 82, SEQ ID NO: 84, SEQ ID NO: 86, SEQ ID NO: 88, SEQ ID NO: 90, SEQ ID Nucleotide sequence of SEQ ID NO: 92, SEQ ID NO: 94, SEQ ID NO: 96, SEQ ID NO: 98, SEQ ID NO: 100 or SEQ ID NO: 102, or Accession Nos. 98936, 98937, 98938 , 98939, 98940, 98941, 98942, 98943, 98944, 98945, 98946, 98947, 98948, 98949, 98950, 98951, 98991, 98993 It is a nucleic acid molecule having a nucleotide sequence with other nucleotide sequences of the inserted DNA sequence of the plasmid deposited with ATCC 98 994 as the call is intended to be within the scope of the invention. For example, other PCIP cDNAs can be identified based on the nucleotide sequence of human PCIP. Furthermore, encoding the PCIP protein from other species results in SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 5, SEQ ID NO: 7, SEQ ID NO: 9, SEQ ID NO: 11, SEQ ID NO: 13, SEQ ID NO: 15, SEQ ID NO: 17, SEQ ID NO: 19, SEQ ID NO: 21, SEQ ID NO: 23, SEQ ID NO: 25, SEQ ID NO: 27, SEQ ID NO: 29, SEQ ID NO: 31, SEQ ID NO: 33, SEQ ID NO: 35, SEQ ID NO: 37, SEQ ID NO: 39, SEQ ID NO: 46, SEQ ID NO: 47, SEQ ID NO: 48, SEQ ID NO: 50, SEQ ID NO: 52, SEQ ID NO: 54, SEQ ID NO: 56, SEQ ID NO: 58, SEQ ID NO: 69, SEQ ID NO: 71, SEQ ID NO: 74, SEQ ID NO: 75, SEQ ID NO: 77, SEQ ID NO: 79, SEQ ID NO: 80, SEQ ID NO: 82, SEQ ID NO: 84, SEQ ID NO: 86, SEQ ID NO: 88, SEQ ID NO: 90, PCIP sequence of SEQ ID NO: 92, SEQ ID NO: 94, SEQ ID NO: 96, SEQ ID NO: 98, SEQ ID NO: 100 or SEQ ID NO: 102, or Accession Nos. 98936, 98937, 98938, 98939, 98940, 98941, 98942, 98943, 98944, 98945, 98946, 98947, 98948, 98949, 98950 , 98951, 98991, 98993 Or nucleic acid molecules having a nucleotide sequence different from the nucleotide sequence of the DNA insertion sequence of the plasmid deposited with ATCC as No. 98994 are also within the scope of the present invention. For example, mouse PCIP cDNA can be identified based on the nucleotide sequence of human PCIP.
[169] Nucleic acid molecules corresponding to natural allelic variants and analogs of the PCIP cDNAs of the invention are disclosed herein using cDNAs or portions thereof disclosed herein as hybridization probes under strict hybridization conditions, according to standard hybridization techniques. It can be isolated based on their homology to.
[170] Thus, in another embodiment, an isolated nucleic acid molecule of the invention is at least 15, 20, 25, 30 or more nucleotides in length and comprises SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 5, SEQ ID NO : 7, SEQ ID NO: 9, SEQ ID NO: 11, SEQ ID NO: 13, SEQ ID NO: 15, SEQ ID NO: 17, SEQ ID NO: 19, SEQ ID NO: 21, SEQ ID NO: 23 , SEQ ID NO: 25, SEQ ID NO: 27, SEQ ID NO: 29, SEQ ID NO: 31, SEQ ID NO: 33, SEQ ID NO: 35, SEQ ID NO: 37, SEQ ID NO: 39, SEQ ID NO: 46, SEQ ID NO: 47, SEQ ID NO: 48, SEQ ID NO: 50, SEQ ID NO: 52, SEQ ID NO: 54, SEQ ID NO: 56, SEQ ID NO: 58, SEQ ID NO : 69, SEQ ID NO: 71, SEQ ID NO: 74, SEQ ID NO: 75, SEQ ID NO: 77, SEQ ID NO: 79, SEQ ID NO: 80, SEQ ID NO: 82, SEQ ID NO: 84 , SEQ ID NO: 86, SEQ ID NO: 88, SEQ ID NO: 90, SEQ ID NO: 92, SEQ ID NO: 94, SEQ ID NO: 96, SEQ ID NO: 98, SEQ ID NO: 100 or SEQ Nucleotide sequence of ID NO: 102 or Accession Nos. 98936, 98937, 98938, 98939, 98940, 98941, 98942, 98943, 98944, 98945, 98946, 98 947, 98948, 98949, 98950, 98951, 98991, 98993, or 98994, which are stringent nucleic acid molecules comprising the nucleotide sequence of the DNA insertion sequence of the plasmid deposited in the ATCC. Hybridize under conditions. In other embodiments, the nucleic acid has a length of at least 30, 50, 100, 150, 200, 250, 300, 307, 350, 400, 450, 500, 550, 600, 650, 700, 750, 800, 850, 900, 949, or 950 nucleotides. As used herein, the term “hybridization under strict conditions” is intended to describe the conditions for hybridization and washing under conditions where nucleotide sequences that are at least 60% identical to each other typically hybridize to each other. Preferably, due to this condition, sequences of at least about 70%, more preferably at least about 80%, most preferably at least about 85% or 90% identical to each other typically remain hybridized with each other.
[171] Such stringent conditions are known to those skilled in the art and can be found in Current Protocols in Molecular Biology, Ausubel et al., John Wiley & Sons, Inc. (1995), sections 2, 4 and 6. Further stringent conditions can also be found in Molecular Cloning: A Laboratory Manual, Sambrook et al., Cold Spring Harbor Press, Cold Spring Harbor, NY (1989), chapters 7, 9 and 11. Preferred and non-limiting examples of stringent hybridization conditions include hybridization in 4x sodium chloride / sodium citrate (SSC) at about 65-70 ° C (or alternatively, 4x SSC plus 50% form at about 42-50 ° C). Hybridization in amides), followed by one or more washes in 1 × SSC at about 65-70 ° C. Preferred and non-limiting examples of very stringent hybridization conditions include hybridization at 1 × SSC at about 65-70 ° C. (or alternatively hybridization at 1 × SSC plus 50% formamide at about 42-50 ° C.). After washing, washing at least once in 0.3 × SSC at about 65-70 ° C. is included. Preferred and non-limiting examples of less stringent hybridization conditions include hybridization at 4 × SSC at about 50-60 ° C. (or alternatively hybridization at 6 × SSC plus 50% formamide at about 40-45 ° C.). Afterwards, one or more washes in 2 × SSC at about 50-60 ° C. Intermediate ranges for the above mentioned values, such as 65-70 ° C or 42-50 ° C, are also intended to be included in the present invention. SSPE (1x SSPE is 0.15M NaCl, 10mM NaH ₂ PO ₄ and 1.25mM EDTA, pH 7.4) will be replaced with SSC (1x SSC is 0.15M NaCl and 15mM sodium citrate) as a buffer for hybridization and washing Can be; The wash is performed for 15 minutes every time after hybridization is complete. The hybridization temperature for hybrids predicted with less than 50 base pairs in length should be 5-10 ° C. below the melting point (T _m ) of the hybrid, where T _m is determined according to the formula below. For hybrids of less than 18 base pairs in length, T _m (° C.) = 2 (number of A + T base) +4 (number of G + C base). For hybrids with 18 to 49 base pairs in length, T _m (° C.) = 81.5 + 16.6 (log ₁₀ [Na ⁺ ]) + 0.41 (% G + C)-(600 / N), where N is in the hybrid Number of bases, [Na ⁺ ] is the concentration of sodium ions in the hybridization buffer ([Na ⁺ ] for 1 × SSC is 0.165M). Additional reagents such as, but not limited to, blocking agents (eg, BSA or sperm carrier DNA of salmon or herring), detergents to reduce nonspecific hybridization of nucleic acid molecules to membranes Nitrocellulose or nylon membranes can be added, including (eg, SDS), chelating agents (eg, EDTA), Picol, PVP, and the like. Particularly preferred non-limiting examples of stringent hybridization conditions when using nylon membranes are: 0.02 M at 65 ° C. after hybridization in 0.25-0.5 M NaH ₂ PO ₄ and 7% SOS at about 65 ° C. One or more washes in NaH ₂ PO ₄ and 1% SOS (Church and Gilbert (1984) Proc. Natl. Acad. Sci. USA 81: 1991-1995) or alternatively in 0.2 × SSC and 1% SDS. It is to let.
[172] Preferably, the isolated nucleic acid molecules of the present invention which hybridize to the sequence of SEQ ID NO: 1 under stringent conditions correspond to naturally occurring nucleic acid molecules. As described herein, a "naturally occurring" nucleic acid molecule refers to an RNA or DNA molecule having a naturally occurring nucleotide sequence (encoding a natural protein).
[173] In addition to naturally occurring allelic variants of the PCIP sequences that may be present in a population, those skilled in the art will further include SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 5, SEQ ID NO: 7, SEQ ID NO: 9, SEQ ID NO: 11, SEQ ID NO: 13, SEQ ID NO: 15, SEQ ID NO: 17, SEQ ID NO: 19, SEQ ID NO: 21, SEQ ID NO: 23, SEQ ID NO: 25, SEQ ID NO: 27, SEQ ID NO: 29, SEQ ID NO: 31, SEQ ID NO: 33, SEQ ID NO: 35, SEQ ID NO: 37, SEQ ID NO: 39, SEQ ID NO: 46, SEQ ID NO: 47, SEQ ID NO: 48, SEQ ID NO: 50, SEQ ID NO: 52, SEQ ID NO: 54, SEQ ID NO: 56, SEQ ID NO: 58, SEQ ID NO: 69, SEQ ID NO: 71, SEQ ID NO: 74, SEQ ID NO: 75, SEQ ID NO: 77, SEQ ID NO: 79, SEQ ID NO: 80, SEQ ID NO: 82, SEQ ID NO: 84, SEQ ID NO: 86, SEQ ID NO : Nucleotide sequence or accession number of: 88, SEQ ID NO: 90, SEQ ID NO: 92, SEQ ID NO: 94, SEQ ID NO: 96, SEQ ID NO: 98, SEQ ID NO: 100, or SEQ ID NO: 102 98936, 98937, 98938, 98939, 98940, 98941, 98942, 98943, 98944, 98945, 98946, 98947, 98948 It will be appreciated that, as 98949, 98950, 98951, 98991, 98993 or 98994, they can be introduced by mutation into the nucleotide sequence of the DNA insert of the plasmid deposited in the ATCC, Thus, the amino acid sequence of the encoded PCIP protein will be altered without modifying the functional capacity of the PCIP protein. For example, nucleotide substitutions that cause amino acid substitutions at “non-essential” amino acid residues include SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 5, SEQ ID NO: 7, SEQ ID NO: 9, SEQ ID NO: 11, SEQ ID NO: 13, SEQ ID NO: 15, SEQ ID NO: 17, SEQ ID NO: 19, SEQ ID NO: 21, SEQ ID NO: 23, SEQ ID NO: 25, SEQ ID NO : 27, SEQ ID NO: 29, SEQ ID NO: 31, SEQ ID NO: 33, SEQ ID NO: 35, SEQ ID NO: 37, SEQ ID NO: 39, SEQ ID NO: 46, SEQ ID NO: 47 , SEQ ID NO: 48, SEQ ID NO: 50, SEQ ID NO: 52, SEQ ID NO: 54, SEQ ID NO: 56, SEQ ID NO: 58, SEQ ID NO: 69, SEQ ID NO: 71, SEQ ID NO: 74, SEQ ID NO: 75, SEQ ID NO: 77, SEQ ID NO: 79, SEQ ID NO: 80, SEQ ID NO: 82, SEQ ID NO: 84, SEQ ID NO: 86, SEQ ID NO : Nucleotide sequence or accession number of: 88, SEQ ID NO: 90, SEQ ID NO: 92, SEQ ID NO: 94, SEQ ID NO: 96, SEQ ID NO: 98, SEQ ID NO: 100, or SEQ ID NO: 102 98936, 98937, 98938, 98939, 98940, 98941, 98942, 98943, 98944, 98945, 98946, 98947, 9 8948, 98949, 98950, 98951, 98991, 98993, or 98994, which can be made in the nucleotide sequence of the DNA insert of the plasmid deposited in the ATCC. A “non-essential” amino acid residue is a wild type sequence of PCIP (eg, SEQ ID NO: 2, SEQ ID NO: 4, SEQ ID NO: 6, SEQ ID NO: 8, SEQ ID NO: 10, SEQ ID NO: 12, SEQ ID NO: 14, SEQ ID NO: 16, SEQ ID NO: 18, SEQ ID NO: 20, SEQ ID NO: 22, SEQ ID NO: 24, SEQ ID NO: 26, SEQ ID NO: 28, SEQ ID NO: 30, SEQ ID NO: 32, SEQ ID NO: 34, SEQ ID NO: 36, SEQ ID NO: 38, SEQ ID NO: 40, SEQ ID NO: 49, SEQ ID NO: 51, SEQ ID NO: 53, SEQ ID NO: 55, SEQ ID NO: 57, SEQ ID NO: 59, SEQ ID NO: 70, SEQ ID NO: 72, SEQ ID NO: 76, SEQ ID NO: 78, SEQ ID NO: 81, SEQ ID NO: 83, SEQ ID NO: 85, SEQ ID NO: 87, SEQ ID NO: 89, SEQ ID NO: 91, SEQ ID NO: 93, SEQ ID NO: 95, Amino acid residues that can be modified from SEQ ID NO: 97, SEQ ID NO: 99, SEQ ID NO: 101, SEQ ID NO: 103, or the sequence of SEQ ID NO: 109), while “essential” amino acid residues exhibit biological activity. Is essential. For example, amino acid residues that are conserved between PCIP proteins of the invention are not expected to be particularly modified. Moreover, additional amino acid residues that are conserved between the PCIP protein of the invention and other members of the PCIP family protein will not be modified and modified.
[174] Accordingly, another aspect of the present invention relates to nucleic acid molecules encoding PCIP proteins in which amino acid residues that are not essential for activity are altered. Such PCIP proteins are SEQ ID NO: 2, SEQ ID NO: 4, SEQ ID NO: 6, SEQ ID NO: 8, SEQID NO: 10, SEQ ID NO: 12, SEQ ID NO: 14, SEQ in terms of amino acid sequence ID NO: 16, SEQ ID NO: 18, SEQ ID NO: 20, SEQ ID NO: 22, SEQ ID NO: 24, SEQ ID NO: 26, SEQ ID NO: 28, SEQ ID NO: 30, SEQ ID NO : 32, SEQ ID NO: 34, SEQ ID NO: 36, SEQ ID NO: 38, SEQ ID NO: 40, SEQ ID NO: 49, SEQ ID NO: 51, SEQ ID NO: 53, SEQ ID NO: 55 , SEQ ID NO: 57, SEQ ID NO: 59, SEQ ID NO: 70, SEQ ID NO: 72, SEQ ID NO: 76, SEQ ID NO: 78, SEQ ID NO: 81, SEQ ID NO: 83, SEQ ID NO: 85, SEQ ID NO: 87, SEQ ID NO: 89, SEQ ID NO: 91, SEQ ID NO: 93, SEQ ID NO: 95, SEQ ID NO: 97, SEQ ID NO: 99, SEQ ID NO : 101, different from SEQ ID NO: 103 or SEQ ID NO: 109, and still retains biological activity. In one embodiment, the isolated nucleic acid molecule comprises a nucleotide sequence encoding a protein, wherein the protein comprises SEQ ID NO: 2, SEQ ID NO: 4, SEQ ID NO: 6, SEQ ID NO: 8, SEQ ID NO: 10, SEQ ID NO: 12, SEQ ID NO: 14, SEQ ID NO: 16, SEQ ID NO: 18, SEQ ID NO: 20, SEQ ID NO: 22, SEQ ID NO: 24, SEQ ID NO: 26, SEQ ID NO: 28, SEQ ID NO: 30, SEQ ID NO: 32, SEQ ID NO: 34, SEQ ID NO: 36, SEQ ID NO: 38, SEQ ID NO: 40, SEQ ID NO: 49, SEQ ID NO: 51, SEQ ID NO: 53, SEQ ID NO: 55, SEQ ID NO: 57, SEQ ID NO: 59, SEQ ID NO: 70, SEQ ID NO: 72, SEQ ID NO: 76, SEQ ID NO: 78, SEQ ID NO: 81, SEQ ID NO: 83, SEQ ID NO: 85, SEQ ID NO: 87, SEQ ID NO: 89, SEQ ID NO: 91, SEQ ID NO: 93, SEQ ID NO: 95, SEQ ID NO: 97, SEQ ID NO: 99, SEQ ID NO: 101, SEQ ID NO: 103, or about 50% or more, 55%, 60%, 65%, 70%, 75 with SEQ ID NO: 109 %, 80%, 85%, 90%, 95% or more identical amino acid sequences.
[175] SEQ ID NO: 2, SEQ ID NO: 4, SEQ ID NO: 6, SEQ ID NO: 8, SEQ ID NO: 10, SEQID NO: 12, SEQ ID NO: 14, SEQ ID NO: 16, SEQ ID NO : 18, SEQ ID NO: 20, SEQ ID NO: 22, SEQ ID NO: 24, SEQ ID NO: 26, SEQ ID NO: 28, SEQ ID NO: 30, SEQ ID NO: 32, SEQ ID NO: 34 , SEQ ID NO: 36, SEQ ID NO: 38, SEQ ID NO: 40, SEQ ID NO: 49, SEQ ID NO: 51, SEQ ID NO: 53, SEQ ID NO: 55, SEQ ID NO: 57, SEQ ID NO: 59, SEQ ID NO: 70, SEQ ID NO: 72, SEQ ID NO: 76, SEQ ID NO: 78, SEQ ID NO: 81, SEQ ID NO: 83, SEQ ID NO: 85, SEQ ID NO : 87, SEQ ID NO: 89, SEQ ID NO: 91, SEQ ID NO: 93, SEQ ID NO: 95, SEQ ID NO: 97, SEQ ID NO: 99, SEQ ID NO: 101, SEQ ID NO: 103 Or an isolated nucleic acid molecule encoding a PCIP protein similar to the protein of SEQ ID NO: 109, SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 5, SEQ ID NO: 7, SEQ ID NO: 9, SEQ ID NO: 11, SEQ ID NO: 13, SEQ ID NO: 15, SEQ ID NO: 17, SEQ ID NO: 19, SEQ ID NO: 21, SEQ ID NO: 23, SEQ ID NO: 25, SEQ ID NO: 27, SEQ ID NO: 29, SEQ ID NO: 31, SEQ ID NO: 33, SEQ ID NO: 35, SEQ ID NO: 37, SEQ ID NO: 39, SEQ ID NO: 46, SEQ ID NO: 47, SEQ I D NO: 48, SEQ ID NO: 50, SEQ ID NO: 52, SEQ ID NO: 54, SEQ ID NO: 56, SEQ ID NO: 58, SEQ ID NO: 69, SEQ ID NO: 71, SEQ ID NO : 74, SEQ ID NO: 75, SEQ ID NO: 77, SEQ ID NO: 79, SEQ ID NO: 80, SEQ ID NO: 82, SEQ ID NO: 84, SEQ ID NO: 86, SEQ ID NO: 88 Nucleotide sequence of SEQ ID NO: 90, SEQ ID NO: 92, SEQ ID NO: 94, SEQ ID NO: 96, SEQ ID NO: 98, SEQ ID NO: 100, or SEQ ID NO: 102, or Accession No. 98936 No. 98937, 98938, 98939, 98940, 98941, 98942, 98943, 98944, 98945, 98946, 98947, 98948, Produced by introducing one or more nucleotide substitutions, additions or deletions into the nucleotide sequence of the DNA insertion of a plasmid deposited with ATCC as 98949, 98950, 98951, 98991, 98993 or 98994. As such, one or more amino acid substitutions, additions, or deletions are introduced into the encoded protein. SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 5, SEQ ID NO: 7, SEQ ID NO: 9, SEQ ID NO: 11, SEQ ID NO: 13, SEQ ID NO: 15, SEQ ID NO: 17, SEQ ID NO: 19, SEQ ID NO: 21, SEQ ID NO: 23, SEQ ID NO: 25, SEQ ID NO: 27, SEQ ID NO: 29, SEQ ID NO: 31, SEQ ID NO: 33, SEQ ID NO: 35, SEQ ID NO: 37, SEQ ID NO: 39, SEQ ID NO: 46, SEQ ID NO: 47, SEQ ID NO: 48, SEQ ID NO: 50, SEQ ID NO: 52, SEQ ID NO: 54, SEQ ID NO: 56, SEQ ID NO: 58, SEQ ID NO: 69, SEQ ID NO: 71, SEQ ID NO: 74, SEQ ID NO: 75, SEQ ID NO: 77, SEQ ID NO: 79, SEQ ID NO: 80, SEQ ID NO: 82, SEQ ID NO: 84, SEQ ID NO: 86, SEQ ID NO: 88, SEQ ID NO: 90, SEQ ID NO: 92, SEQ ID NO: 94, SEQ ID NO: 96, SEQ ID NO: 98, SEQ ID NO: 100 or the nucleotide sequence of SEQ ID NO: 102 or Accession Nos. 98936, 98937, 98938, 98939, 98940 , 98941, 98942, 98943, 98944, 98945, 98946, 98947, 98948, 98949, 98950, 98951, 98991, 9 A flask deposited with ATCC as 98993 or 98994; Mutations can be introduced by standard techniques such as site-specific mutagenesis and PCR-mediated mutagenesis into the nucleotide sequence of the DNA insert of the mead. Preferably, substitution of conservative amino acids is made at one or more expected non-essential amino acid residues. "Conservative amino acid substitutions" are substitutions in which amino acid residues are substituted with amino acid residues having similar side chains. Family of amino acid residues with similar side chains are defined in the art. This family includes basic side chains (eg lysine, arginine, histidine), acidic side chains (eg aspartic acid, glutamic acid), uncharged polar side chains (eg glycine, asparagine, glutamine, serine, threonine, tyrosine, cysteine), nonpolar Side chains (e.g. alanine, valine, leucine, isoleucine, proline, phenylalanine, methionine, tryptophan), beta branched side chains (e.g. threonine, valine, isoleucine) and aromatic side chains (e.g. tyrosine, phenylalanine, tryptophan, histidine) Contains amino acids. Thus, non-essential amino acid residues expected in PCIP proteins are preferably substituted with other amino acid residues from the same side chain family. Further, in other embodiments, the mutations can be introduced randomly along some or all of the PCIP coding sequence, such as by saturation mutagenesis, and the resulting mutants can be identified to identify PCIP biological activity to maintain the activity. Can be screened for. SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 5, SEQ ID NO: 7, SEQ ID NO: 9, SEQ ID NO: 11, SEQ ID NO: 13, SEQ ID NO: 15, SEQ ID NO: 17, SEQ ID NO: 19, SEQ ID NO: 21, SEQ ID NO: 23, SEQ ID NO: 25, SEQ ID NO: 27, SEQ ID NO: 29, SEQ ID NO: 31, SEQ ID NO: 33, SEQ ID NO: 35, SEQ ID NO: 37, SEQ ID NO: 39, SEQ ID NO: 46, SEQ ID NO: 47, SEQ ID NO: 48, SEQ ID NO: 50, SEQ ID NO: 52, SEQ ID NO: 54, SEQ ID NO: 56, SEQ ID NO: 58, SEQ ID NO: 69, SEQ ID NO: 71, SEQ ID NO: 74, SEQ ID NO: 75, SEQ ID NO: 77, SEQ ID NO: 79, SEQ ID NO: 80, SEQ ID NO: 82, SEQ ID NO: 84, SEQ ID NO: 86, SEQ ID NO: 88, SEQ ID NO: 90, SEQ ID NO: 92, SEQ ID NO: 94, SEQ ID NO: 96, SEQ ID NO: 98, SEQ ID NO: 100 or the nucleotide sequence of SEQ ID NO: 102 or Accession Nos. 98936, 98937, 98938, 98939, 98940 , 98941, 98942, 98943, 98944, 98945, 98946, 98947, 98948, 98949, 98950, 98951, 98991, 9 A flask deposited with ATCC as 98993 or 98994; After mutagenesis of the nucleotide sequence of the DNA insert of the mead occurs, the encoded protein can be expressed recombinantly and the activity of the protein can be measured.
[176] In a preferred embodiment, the mutant PCIP protein (1) interacts with (eg, binds to) a potassium channel protein or portion thereof, (2) regulates the phosphorylation status of the potassium channel protein or portion thereof, and (3) relates to calcium (E.g., bound), such as acting as a calcium dependent kinase, phosphorylating potassium channels, e.g., in a calcium dependent manner, (4) associated with (e.g., bound) calcium, e.g. ) Modulate potassium channel mediated activity in cells (eg neurons or heart cells), such as beneficially affecting cells, (6) controlling the release of neurotransmitters, (7) regulating membrane excitability (8) the ability to influence the resting potential of the membrane, (9) to control the frequency of waveforms and action potentials, and (10) to control the threshold of stimulation.
[177] In addition to the nucleic acid molecules encoding the PCIP proteins described above, another aspect of the invention relates to isolated nucleic acid molecules that are antisense. An “antisense” nucleic acid includes a nucleotide sequence that is a complementary sequence to a “sense” nucleic acid encoding a protein, such as a complementary sequence to a coding strand of a double stranded cDNA molecule or to an mRNA sequence. Is capable of hydrogen bonding to a sense nucleic acid.An antisense nucleic acid may be a complementary sequence to a complete PCIP coding strand, or just a portion thereof. In one embodiment, the antisense nucleic acid molecule is a "strand of the coding strand of the nucleotide sequence encoding Coding region ". The term" coding region "refers to a region of the nucleotide sequence comprising a codon translated into an amino acid residue. In another embodiment, the antisense nucleic acid molecule encodes a nucleotide sequence that encodes PCIP. Antisense to the “non-coding region” of the strand The term “non-coding region” is translated into amino acids And 5 'and 3' sequences flanking coding regions (also referred to as 5 'and 3' untranslated regions).
[178] In the case of the coding strand sequence encoding the PCIP disclosed herein, the antisense nucleic acids of the invention can be designed according to the Law of Watson and Crick base pairs. The antisense nucleic acid molecule may be a complementary sequence to the complete coding region of the PCIP mRNA, but more preferably is an oligonucleotide that is antisense to only a portion of the coding or non-coding region of the PCIP mRNA. For example, the antisense oligonucleotide may be a complementary sequence to the region surrounding the translation initiation site of PCIP mRNA. The length of the antisense oligonucleotides can be, for example, about 5, 10, 15, 20, 25, 30, 35, 40, 45 or 50 nucleotides. Antisense nucleic acids of the invention can be produced using chemical synthesis and enzyme ligation reactions using procedures known in the art. For example, antisense nucleic acids (eg, antisense oligonucleotides) are naturally occurring nucleotides or variously modified nucleotides designed to increase the biological stability of a molecule or to increase the physical stability of duplexes formed between antisense and sense nucleic acids. Can be chemically synthesized, such as phosphorothioate derivatives and acridine substituted nucleotides. Examples of modified nucleotides that can be used to generate antisense nucleic acids include 5-fluorouracil, 5-bromouracil, 5-chlorouracil, 5-iodouracil, hypoxanthine, xanthine, 4-acetylcytosine, 5- ( Carboxyhydroxymethyl) uracil, 5-carboxymethylaminomethyl-2-thiouridine, 5-carboxymethylaminomethyluracil, dihydrouracil, beta-D-galactosylquiosine, inosine, N6-isopentenyladenin, 1-methylguanine, 1-methylinosine, 2,2-dimethylguanine, 2-methyladenine, 2-methylguanine, 3-methylcytosine, 5-methylcytosine, N6-adenine, 7-methylguanine, 5-methylamino Methyluracil, 5-methoxyaminomethyl-2-thiouracil, beta-D-mannosylquiosine, 5'-methoxycarboxymethyluracil, 5-methoxyuracil, 2-methylthio-N6-isopentenyladenin , Uracil-5-oxyacetic acid (v), ibutoxosin, pseudouracil, quiocin, 2-thiocytosine, 5-methyl-2-thiouracil , 2-thiouracil, 4-thiouracil, 5-methyluracil, uracil-5-oxyacetic acid, methyl ester, uracil-5-oxyacetic acid (v), 5-methyl-2-thiouracil, 3- (3- Amino-3-N-2-carboxypropyl) uracil, (acp3) w, and 2,6-diaminopurine. In addition, antisense nucleic acids can be prepared biologically using expression vectors in which nucleic acids have been subcloned in antisense orientation (ie, RNA transcribed from the inserted nucleic acid will be antisense oriented relative to the important target nucleic acid further described in the following paragraphs). ).
[179] Antisense nucleic acid molecules of the invention are typically generated in situ or are typically administered to a subject so that they hybridize or bind to genomic DNA and / or cellular mRNAs encoding PCIP proteins, eg, for transcription and / or translation. Inhibits the expression of the protein. Hybridization forms stable duplexes or in the case of antisense nucleic acid molecules that bind to a DNA duplex via specific interactions in the major groove of the double helix by conventional nucleotide complementarity. Examples of routes of administration of the antisense nucleic acid molecules of the invention include injecting directly at the tissue site. In addition, antisense nucleic acid molecules can be modified and systemically administered to cells selected for targeting. For example, in systemic administration, antisense molecules can be bound to, for example, a peptide or an antibody that binds an antisense nucleic acid molecule to a cell surface receptor or antigen, such that they specifically bind to a receptor or antigen expressed on a selected cell surface. Can be modified. In addition, antisense nucleic acid molecules can be delivered to cells using the vectors disclosed herein. In order to achieve sufficient intracellular concentration of the antisense molecule, it is preferred that the antisense nucleic acid molecule is a vector construct positioned under the control of a strong pol II or pol III promoter.
[180] In another embodiment, the antisense nucleic acid molecule of the invention is an α-anomeric nucleic acid molecule. Unlike conventional β-units, α-anomeric nucleic acid molecules form hybrids of complementary RNA with specific double strands parallel to each other (Gaultier et al. (1987) Nucleic Acids. Res. 15: 6625- 6641). In addition, the antisense nucleic acid molecule may be a 2'-o-methylribonucleotide (Inoue et al. (1987) Nucleic Acids Res. 15: 6131-6148) or a chimeric RNA-DNA analog (Inoue et al. (1987) FEBS Lett. 215 : 327-330).
[181] In another embodiment, the antisense nucleic acids of the invention are ribozymes. Ribozymes are catalytic RNA molecules with ribonuclease activity that can cleave a single strand of nucleic acid, such as mRNA, having complementary regions. Thus, ribozymes (e.g., hammerhead and gerlach (described in Haselhoff and Gerlach (1988) Nature 334: 585-591)) are used to catalyze the cleavage of PCIP mRNA transcripts to inhibit translation of PCIP mRNA. can do. Ribozymes having specificity for PCIP encoding nucleic acids are described herein as PCIP cDNA (ie SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 5, SEQ ID NO: 7, SEQ ID NO: 9, SEQ ID NO: 11, SEQ ID NO: 13, SEQ ID NO: 15, SEQ ID NO: 17, SEQ ID NO: 19, SEQ ID NO: 21, SEQ ID NO: 23, SEQ ID NO: 25, SEQ ID NO : 27, SEQ ID NO: 29, SEQ ID NO: 31, SEQ ID NO: 33, SEQ ID NO: 35, SEQ ID NO: 37, SEQ ID NO: 39, SEQ ID NO: 46, SEQ ID NO: 47 , SEQ ID NO: 48, SEQ ID NO: 50, SEQ ID NO: 52, SEQ ID NO: 54, SEQ ID NO: 56, SEQ ID NO: 58, SEQ ID NO: 69, SEQ ID NO: 71, SEQ ID NO: 74, SEQ ID NO: 75, SEQ ID NO: 77, SEQ ID NO: 79, SEQ ID NO: 80, SEQ ID NO: 82, SEQ ID NO: 84, SEQ ID NO: 86, SEQ ID NO : Nucleotide sequence or accession number of: 88, SEQ ID NO: 90, SEQ ID NO: 92, SEQ ID NO: 94, SEQ ID NO: 96, SEQ ID NO: 98, SEQ ID NO: 100, or SEQ ID NO: 102 98936, 98937, 98938, 98939, 98940, 98941, 98942, 98943, 98944, 98945, 98946, 98947, 98948 No. 98949, 9 8950, 98951, 98991, 98993, or 98994 can be designed based on the nucleotide sequence of the nucleotide sequence of the DNA insertion of the plasmid deposited in the ATCC. For example, derivatives of Tetrahymena L-19 IVS RNA can be made complementary to the nucleotide sequence in which the nucleotide sequence of the active site is cleaved from the PCIP-encoding mRNA. In this regard, see Cech et al. US Patent No. 4,987,071; And Cech et al. See U.S. Patent 5,116,742. In addition, PCIP mRNA can be used to select catalytic RNA with specific ribonuclease activity from the pool of RNA molecules. See, for example, Bartel, D. and Szostak, J.W. (1993) Science 261: 1411-1418.
[182] In addition, PCIP gene expression is inhibited by targeting nucleotide sequences complementary to the regulatory regions of PCIP (eg, PCIP promoters and / or enhancers) to form triple helix structures that prevent transcription of the PCIP gene in target cells. can do. This is generally described in Helene, C. (1991) Anticancer Drug Des. 6 (6): 569-84; Helene, C. et al. (1992) Ann. N.Y. Acad. Sci. 660-27-36; and Maher, L.J. (1992) Bioassays 14 (12): 807-15.
[183] In another embodiment, the PCIP nucleic acid molecules of the invention can be modified in the base moiety, sugar moiety, phosphate backbone, such as to enhance the stability, hybridization or solubility of the molecule. For example, the deoxyribose phosphate backbone of nucleic acid molecules can be modified to generate peptide nucleic acids (Hyrup B. et al. (1996) Bioorganic & Medicinal Chemistry 4 (1): 5-23). As used herein, the term "peptide nucleic acid" or "PNA" backbone refers to a nucleic acid mimetic, such as a DNA mimetic, wherein the deoxyribose phosphate backbone is replaced by a pseudopeptide backbone and only four natural silkworms The cleobase is maintained. It appears that the natural backbone of PNA can specifically hybridize DNA and RNA under conditions of low ionic strength. PNA oligomers are described in Hyrup B. et al. (1996) supra; Perry-O'Keefe et al. Proc. Natl. Acad. Sci. 93: 14670-675, can be synthesized using standard solid phase peptide synthesis protocol.
[184] PNAs of PCIP nucleic acid molecules can be used in the therapeutic and diagnostic field. For example, PNA can be used as an antisense or antigenic agent to sequence-specifically regulate gene expression, for example by inducing transcription or translation arrests or by inhibiting replication. PNAs of PCIP nucleic acid molecules are also analyzed when analyzing single base pair mutations in one gene (eg, by PNA derived PCR clamping); As 'artificial restriction enzyme' when used with other enzymes (eg, S1 nuclease [Hyrup B. (1996) supra]); Or as a probe or primer for DNA sequencing or hybridization [Ref. Hyrup B. et al . (1996) supra; Perry-O'Keefe supra] can be used.
[185] In another embodiment, the PNA of PCIP is modified by attaching a lipophilic or other helper group to the PNA, forming a PNA-DNA chimera, or using liposomes or other drug delivery techniques known in the art. For example, an increase in their stability or cellular uptake). For example, PNA-DNA chimeras of PCIP nucleic acid molecules can be generated that can combine the beneficial properties of PNA and DNA. Such chimeras allow DNA recognition enzymes (eg, RNAse H and DNA polymerase) to interact with the DNA moiety, while the PNA moiety will provide high binding affinity and specificity. PNA-DNA chimeras can be bound using linkers of suitable lengths selected based on base stacking, number of bonds between nucleobases, and orientation (Hyrup B. (1996) supra). Synthesis of PNA-DNA chimeras is described in Hyrup B. (1996) supra and Finn PJ et al . (1996) Nucleic Acids Res . (24) (17): 3357-63. For example, the DNA chain can be synthesized on a solid support using standard phosphoramidite coupling chemistry and modified modified nucleoside analogs such as 5 '-(4-methoxytrityl) amino-5'- Deoxy-thymidine phosphoramidite can be used as between the 5 'end of PNA and DNA. See Mag, M. et al . (1989) Nucleic Acid Res . 17: 5973-88. Next, the PNA monomers are stepwise coupled with 5'PNA fragments and 3'DNA fragments to generate chimeric molecules [Finn PJ et al . (1996) supra]. Alternatively, chimeric molecules can be synthesized with 5'DNA fragments and 3'PNA fragments. See Peterser, KH et al . (1975) Bioorganic Med. Chem. Lett . 5: 1119-11124.
[186] In other embodiments, oligonucleotides are provided in other subgroups, such as peptides (eg, for targeting host cell receptors in vivo), or agents that facilitate transport across cell membranes [Letsinger et al . (1989) Proc. Natl. Acad. Sci. US . 86: 6553-6556; Lemaitre et al . (1987) Proc. Natl. Acad. Sci. USA 84: 648-652; PCT Publication No. WO88 / 09810 or Blood-Brain Barrier [PCT Publication No. WO89 / 10134]. Oligonucleotides also include hybridization initiated cleavage agents [Krol et al . (1988) Bio-Techniques 6: 958-976] or intercalating agents [Zon (1988) Pharm. Res . 5: 539-549]. For this purpose, oligonucleotides may be conjugated to another molecule (eg, peptide, hybridization initiation crosslinker, transport agent or hybridization initiation cleavage agent).
[187] II. Isolated PCIP Protein and Anti-PCIP Antibodies
[188] One aspect of the invention relates to polypeptide fragments suitable for use as immunogens for culturing the isolated PCIP proteins and their biologically active portions as well as anti-PCIP antibodies. In one embodiment, native PCIP proteins can be isolated from cells or tissue sources by appropriate purification methods using standard protein purification techniques. In another embodiment, the PCIP protein is produced by recombinant DNA technology. As an alternative to recombinant expression, PCIP proteins or polypeptides can be chemically synthesized using standard peptide synthesis techniques.
[189] An "isolated" or "purified" protein or biologically active portion thereof is virtually free of cytosolic or other contaminating proteins from the cell or tissue source from which the PCIP protein is derived, or is a chemical precursor or other chemical when chemically synthesized It contains virtually no substance. As used herein, the expression “contains virtually no cellular material” means less than about 30% (based on dry weight) of non-PCIP proteins (also referred to as “polluted proteins”), more preferably about 20% Preparations of PCIP proteins having less than non-PCIP proteins, even more preferably less than about 10% of non-PCIP proteins, most preferably less than about 5% of non-PCIP proteins. When the PCIP protein or its biologically active portion is produced recombinantly, it is also preferred that it contains virtually no culture medium, ie the culture medium is less than about 20%, more preferably less than about 10% of the volume of the protein preparation, Most preferably less than about 5%.
[190] The expression “substantially free of chemical precursors or other chemicals” includes preparations of PCIP proteins from which proteins are isolated from chemical precursors or other chemicals involved in the synthesis of the protein. In one embodiment, the expression “substantially free of chemical precursors or other chemicals” means less than about 30% (based on dry weight) of chemical precursors or non-PCIP chemicals, more preferably about 20% Preparation of PCIP protein with less than chemical precursors or non-PCIP chemicals, even more preferably less than about 10% chemical precursors or non-PCIP chemicals, most preferably less than about 5% chemical precursors or non-PCIP chemicals It includes.
[191] As used herein, the term "biologically active portion" of a PCIP protein includes fragments of PCIP proteins that participate in interactions between PCIP molecules and non-PCIP molecules. The biologically active portion of the PCIP protein is sufficiently identical to or derived from the amino acid sequence of the PCIP protein, for example SEQ ID NO: 2, SEQ ID NO: 4, SEQ ID NO: 6, SEQ ID NO: 8 , SEQ ID NO: 10, SEQ ID NO: 12, SEQ ID NO: 14, SEQ ID NO: 16, SEQ ID NO: 18, SEQ ID NO: 20, SEQ ID NO: 22, SEQ ID NO: 24, SEQ ID NO: 26, SEQ ID NO: 28, SEQ ID NO: 30, SEQ ID NO: 32, SEQ ID NO: 34, SEQ ID NO: 36, SEQ ID NO: 38, SEQ ID NO: 40, SEQ ID NO : 49, SEQ ID NO: 51, SEQ ID NO: 53, SEQ ID NO: 55, SEQ ID NO: 57, SEQ ID NO: 59, SEQ ID NO: 70, SEQ ID NO: 72, SEQ ID NO: 76 , SEQ ID NO: 78, SEQ ID NO: 81, SEQ ID NO: 83, SEQ IDNO: 85, SEQ ID NO: 87, SEQ ID NO: 89, SEQ ID NO: 91, SEQ ID NO: 93, SEQ ID A peptide comprising an amino acid sequence represented by NO: 95, SEQ ID NO: 97, SEQ ID NO: 99, SEQ ID NO: 101, SEQ ID NO: 103, or SEQ ID NO: 109, wherein said amino acid sequence Is less amino than full-length PCIP protein Acid, which exhibits one or more activities of the PCIP protein. Typically, the biologically active moiety comprises a domain or motif having one or more activities of PCIP proteins, such as binding of potassium channel subunits. The biologically active portion of the PCIP protein may be, for example, a polypeptide having an amino acid length of 10, 25, 50, 100, 200 or more. Biologically active portions of PCIP proteins can be used as targets for developing agents that modulate potassium channel mediated activity.
[192] In one embodiment, the biologically active portion of the PCIP protein comprises at least one calcium binding domain.
[193] It is to be understood that the preferred biologically active portion of the PCIP protein of the invention may contain at least one of the structural domains identified above. More preferred biologically active portions of the PCIP protein may contain at least two of the structural domains identified above. Moreover, other biologically active moieties in which other regions of the protein are deleted can be prepared by recombinant techniques and evaluated for one or more functional activities of the native PCIP protein.
[194] In a preferred embodiment, the PCIP protein comprises SEQ ID NO: 2, SEQ ID NO: 4, SEQ ID NO: 6, SEQ ID NO: 8, SEQ ID NO: 10, SEQ ID NO: 12, SEQ ID NO: 14, SEQ ID NO: 16, SEQ ID NO: 18, SEQ ID NO: 20, SEQ ID NO: 22, SEQ ID NO: 24, SEQ ID NO: 26, SEQ ID NO: 28, SEQ ID NO: 30, SEQ ID NO: 32, SEQ ID NO: 34, SEQ ID NO: 36, SEQ ID NO: 38, SEQ ID NO: 40, SEQ ID NO: 49, SEQ ID NO: 51, SEQ ID NO: 53, SEQ ID NO: 55, SEQ ID NO: 57, SEQ ID NO: 59, SEQ ID NO: 70, SEQ ID NO: 72SEQ ID NO: 76, SEQ ID NO: 78, SEQ ID NO: 81, SEQ ID NO: 83, SEQ ID NO: 85, SEQ ID NO: 87, SEQ ID NO: 89, SEQ ID NO: 91, SEQ ID NO: 93, SEQ ID NO: 95, SEQ ID NO: 97, SEQ ID NO: 99, SEQ ID NO: 101, SEQ ID NO: 103, or SEQ ID NO: 109. In another embodiment, the PCIP protein comprises SEQ ID NO: 2, SEQ ID NO: 4, SEQ ID NO: 6, SEQ ID NO: 8, SEQ ID NO: 10, SEQ ID NO: 12, SEQ ID NO: 14, SEQ ID NO: 16, SEQ ID NO: 18, SEQ ID NO: 20, SEQ ID NO: 22, SEQ ID NO: 24, SEQ ID NO: 26, SEQ ID NO: 28, SEQ ID NO: 30, SEQ ID NO: 32, SEQ ID NO: 34, SEQ ID NO: 36, SEQ ID NO: 38, SEQ ID NO: 40, SEQ ID NO: 49, SEQ ID NO: 51, SEQ ID NO: 53, SEQ ID NO: 55, SEQ ID NO: 57, SEQ ID NO: 59, SEQ ID NO: 70, SEQ ID NO: 72, SEQ ID NO: 76, SEQ ID NO: 78, SEQ ID NO: 81, SEQ ID NO: 83, SEQ ID NO: 85, SEQ ID NO: 87, SEQ ID NO: 89, SEQ ID NO: 91, SEQ ID NO: 93, SEQ ID NO: 95, SEQ ID NO: 97, SEQ ID NO: 99, SEQ ID NO: 101, SEQ ID NO: 103, or SEQ ID NO: 109, substantially identical to SEQ ID NO: 2, SEQ ID NO: 4, SEQ ID NO: 6, SEQ ID NO: 8, SEQ ID NO: 10, SEQ ID NO: 12, SEQ ID NO: 14, SEQ ID NO: 16, SEQ ID NO: 18, SEQ ID NO: 20, SEQ ID NO: 22, SEQ ID NO: 24, SEQ ID NO: 26, SEQ ID NO: 28, SEQ ID NO: 30, SEQ ID NO: 32, SEQ ID NO: 34, SEQ ID NO: 36, SEQ ID NO: 38, SEQ ID NO: 40, SEQ ID NO: 49, SEQ ID NO: 51, SEQ ID NO: 53, SEQ ID NO: 55, SEQ ID NO: 57, SEQ ID NO: 59, SEQ ID NO: 70, SEQ ID NO: 72, SEQ ID NO: 76, SEQ ID NO: 78, SEQ ID NO: 81, SEQ ID NO: 83, SEQ ID NO: 85, SEQ ID NO: 87, SEQ ID NO: 89, SEQ ID Functional of the protein of NO: 91, SEQ ID NO: 93, SEQ ID NO: 95, SEQ ID NO: 97, SEQ ID NO: 99, SEQ ID NO: 101, SEQ ID NO: 103, or SEQ ID NO: 109 Although retaining activity, as described in detail in paragraph I above, amino acid sequences differ due to natural allele mutations or mutagenesis. Thus, in another embodiment, the PCIP protein is SEQ ID NO: 2, SEQ ID NO: 4, SEQ ID NO: 6, SEQ ID NO: 8, SEQ ID NO: 10, SEQ ID NO: 12, SEQ ID NO : 14, SEQ ID NO: 16, SEQ ID NO: 18, SEQ ID NO: 22, SEQ ID NO: 24, SEQ ID NO: 26, SEQ ID NO: 28, SEQ ID NO: 30, SEQ ID NO: 32 , SEQ ID NO: 34, SEQ ID NO: 36, SEQ ID NO: 38, SEQ ID NO: 40, SEQ ID NO: 49, SEQ ID NO: 51, SEQ ID NO: 53, SEQ ID NO: 55, SEQ ID NO: 57, SEQ ID NO: 59, SEQ ID NO: 70, SEQ ID NO: 72, SEQ ID NO: 76, SEQ ID NO: 78, SEQ ID NO: 81, SEQ ID NO: 83, SEQ ID NO : 85, SEQ ID NO: 87, SEQ ID NO: 89, SEQ ID NO: 91, SEQ ID NO: 93, SEQ ID NO: 95, SEQ ID NO: 97, SEQ ID NO: 99, SEQ ID NO: 101 , SEQ ID NO: 103, or SEQ ID NO: 109 with at least about 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 98% or These are proteins containing the same amino acid sequence.
[195] Isolated proteins of the invention, preferably 1v, 9q, p19, W28559, KChIP4a, KChIP4b, 33b07, 1p or 7s protein, are SEQ ID NO: 2, SEQ ID NO: 4, SEQ ID NO: 6, SEQ ID NO : 8, SEQ ID NO: 10, SEQ ID NO: 12, SEQ ID NO: 14, SEQ ID NO: 16, SEQ ID NO: 18, SEQ ID NO: 20, SEQ ID NO: 22, SEQ ID NO: 24 , SEQ ID NO: 26, SEQ ID NO: 28, SEQ ID NO: 30, SEQ ID NO: 32, SEQ ID NO: 34, SEQ ID NO: 36, SEQ ID NO: 38, SEQ ID NO: 40, SEQ ID NO: 49, SEQ ID NO: 51, SEQ ID NO: 53, SEQ ID NO: 55, SEQ ID NO: 57, SEQ ID NO: 59, SEQ ID NO: 70, SEQ ID NO: 72, SEQ ID NO : 76, SEQ ID NO: 78, SEQ ID NO: 81, SEQ ID NO: 83, SEQ ID NO: 85, SEQ ID NO: 87, SEQ ID NO: 89, SEQ ID NO: 91, SEQ ID NO: 93 Have an amino acid sequence sufficiently identical to the amino acid sequence of SEQ ID NO: 95, SEQ ID NO: 97, SEQ ID NO: 99, SEQ ID NO: 101, SEQ ID NO: 103, or SEQ ID NO: 109, or ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 5, SEQ ID NO: 7, SEQ ID NO: 9, SEQ ID NO: 11, SEQ ID NO: 13, SEQ ID NO: 15, SEQ ID NO : 17, SEQ ID NO: 19, SEQ ID NO: 21, SEQ ID NO: 23, SEQ ID NO: 25, SEQ ID NO: 27, SEQ ID NO: 29, SEQ ID NO: 31, SEQ ID NO: 33, SEQ ID NO: 35, SEQ ID NO: 37, SEQ ID NO: 39, SEQ ID NO: 46, SEQ ID NO: 47, SEQ ID NO: 48, SEQ ID NO: 50, SEQ ID NO: 52, SEQ ID NO: 54, SEQ ID NO: 56, SEQ ID NO: 58, SEQ ID NO: 69, SEQ ID NO: 71, SEQ ID NO: 74, SEQ ID NO: 75, SEQ ID NO: 77, SEQ ID NO: 79, SEQ ID NO: 80, SEQ ID NO: 82, SEQ ID NO: 84, SEQ ID NO: 86, SEQ ID NO: 88, SEQ ID NO: 90, SEQ ID NO: 92, SEQ ID NO: 94, SEQ ID NO: 96, SEQ ID Is encoded by a nucleotide sequence which is sufficiently identical to NO: 98, SEQ ID NO: 100, or SEQ ID NO: 102. As used herein, the term “sufficiently identical” amino acid sequence or nucleotide sequence is sufficient or not in the second amino acid or nucleotide sequence such that the first and second amino acid or nucleotide sequence share a common structural domain or motif and / or common functional activity. Reference is made to a first amino acid or nucleotide sequence containing a minimum of identical or equivalent (eg, amino acid residues with similar side chains) amino acid residues or nucleotides. For example, an amino acid or nucleotide sequence that shares a common structural domain may be at least 30%, 40% or 50% sequence identity, preferably 60% sequence identity, more preferably 70% to across the amino acid sequence of the domain. It has 80% sequence identity, even more preferably 90-95% sequence identity, and contains one or more, preferably two or more structural domains or motifs, which are defined herein as sufficiently identical. Moreover, amino acid or nucleotide sequences that share at least 30%, 40% or 50%, preferably 60%, more preferably 70-80% or 90-95% sequence identity share a common functional activity and thus It is defined herein as being sufficiently identical.
[196] Preferred proteins are PCIP proteins having at least one calcium binding domain and preferably PCIP activity. Other preferred proteins are PCIP proteins with one or more calcium binding domains, and preferably, under stringent hybridization conditions, SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 5, SEQ ID NO: 7, SEQ ID NO: 9, SEQ ID NO: 11, SEQ ID NO: 13, SEQ ID NO: 15, SEQ ID NO: 17, SEQ ID NO: 19, SEQ ID NO: 21, SEQ ID NO: 23, SEQ ID NO : 25, SEQ ID NO: 27, SEQ ID NO: 29, SEQ ID NO: 31, SEQ ID NO: 33, SEQ ID NO: 35, SEQ ID NO: 37, SEQ ID NO: 39, SEQ ID NO: 46, SEQ ID NO: 47, SEQ ID NO: 48, SEQ ID NO: 50, SEQ ID NO: 52, SEQ ID NO: 54, SEQ ID NO: 56, SEQ ID NO: 58, SEQ ID NO: 69, SEQ ID NO: 71, SEQ ID NO: 74, SEQ ID NO: 75, SEQ ID NO: 77, SEQ ID NO: 79, SEQ ID NO: 80, SEQ ID NO: 82, SEQ ID NO: 84, SEQ ID NO: 86, SEQ ID NO: 88, SEQ ID NO: 90, SEQ ID NO: 92, SEQ ID NO: 94, SEQ ID NO: 96, SEQ ID NO: 98, SEQ ID NO: 100, or SEQ ID NO: 102 Nucleic acid sequence having a nucleotide sequence hybridized to a nucleic acid sequence comprising a nucleotide sequence of It is encoded by heat.
[197] To determine the percent identity of two amino acid sequences or two nucleic acid sequences, the sequences are aligned for optimal comparison purposes (e.g., one or two of the first and second amino acid or nucleic acid sequences for optimal alignment) Gaps can be introduced in all, and nonhomologous sequences can be ignored for comparison purposes). In a preferred embodiment, the length of the reference sequence aligned for comparison purposes is at least 30%, preferably at least 40%, more preferably at least 50%, even more preferably at least 60%, even more preferred Is at least 70%, 80% or 90% (e.g., SEQ ID NO: 2, SEQ ID NO: 4, SEQ ID NO: 6, SEQ ID NO: 8, SEQ ID NO: 10, SEQ ID NO: 12, SEQ ID NO: 14, SEQ ID NO: 16, SEQ ID NO: 18, SEQ ID NO: 20, SEQ ID NO: 22, SEQ ID NO: 24, SEQ ID NO: 26, SEQ ID NO: 28, SEQ ID NO: 30, SEQ ID NO: 32, SEQ ID NO: 34, SEQ ID NO: 36, SEQ ID NO: 38, SEQ ID NO: 40, SEQ ID NO: 49, SEQ ID NO: 51, SEQ ID NO: 53, SEQ ID NO: 55, SEQ ID NO: 57, SEQ ID NO: 59, SEQ ID NO: 70, SEQ ID NO: 72, SEQ ID NO: 76, SEQ ID NO: 78, SEQ ID NO: 81, SEQ ID NO: 83, SEQ ID NO: 85, SEQ ID NO: 87, SEQ ID NO: 89, SEQ ID NO: 91, SEQ ID NO: 93, SEQ ID NO: 95, SEQ ID NO: 97, SEQ ID NO: 99, SEQ ID NO: 101, SEQ ID NO: 103, or SEQ ID NO When aligning the second sequence to the PCIP amino acid sequence of: 109, 80 or more, preferably 100 or more, more preferably 120 or more, even more preferably 140 or more, even more preferably 150, 160 or 170 or more Amino acid residues are aligned). The amino acid residues or nucleotides are then compared at the corresponding amino acid position or nucleotide position. When the position of the first sequence is occupied by an amino acid residue or nucleotide that is identical to the corresponding position of the second sequence, the molecule is identical at that position (amino acid or nucleic acid “identity” as used herein refers to an amino acid or nucleic acid “phase”). Same sex "). The percent identity between the two sequences is a function of the number of identical positions shared by the sequences, taking into account the number of gaps and the length of each gap, which need to be introduced for optimal alignment of the two sequences.
[198] Determination of% identity and comparison of sequences between two sequences can be accomplished using a mathematical algorithm. In a preferred embodiment, the percent identity between the two amino acid sequences differs from the Blosum 62 matrix or the PAM250 matrix, and the gap weights of 16, 14, 12, 10, 8, 6 or 4 and 1, 2, 3, 4, 5 or Needleman and Wunsch [ J. Mol. Incorporated into the GAP program in the GCG software package (available from http://www.gcg.com) using a length weight of 6 . Biol . (48): 444-453 (1970)]. In yet another preferred embodiment, the percent identity between the two nucleotide sequences uses the NWSgapdna.CMP matrix and a gap weight of 40, 50, 60, 70 or 80 and a length weight of 1, 2, 3, 4, 5 or 6 Determined using the GAP program of the GCG software package (available from http://www.gcg.com). In another embodiment,% identity between two amino acids or two nucleic acid sequences is incorporated into the ALIGN program (version 2.0 or 2.0U) using a PAM120 weight residue table, a gap length penalty of 12 and a gap penalty of 4. E. Meyers and moreover. It is determined using the algorithm of W. Miller (CABIOS, 4: 11-17 (1989)).
[199] Nucleic acid and protein sequences of the invention can further be used as "query sequences" to examine published databases, for example, to identify other family members or related sequences. Such investigations are described in Altschul, et al . (1990) J. Mol. Biol . 215: 403-10, which can be performed using the NBLAST and XBLAST programs (version 2.0). BLAST nucleotide irradiation to obtain the same nucleotide sequence as the PCIP nucleic acid molecule of the present invention can be performed with the NBLAST program (Score = 100, wordlength = 12). BLAST protein irradiation to obtain the same amino acid sequence as the PCIP protein molecule of the present invention can be performed with the XBLAST program (Score = 50, wordlength = 3). To achieve a gapped alignment for comparison purposes, capped BLAST is described in Altschul et al . (1997) Nucleic Acids Res. 25 (17): 3389-3402. When using BLAST and gapped BLAST programs, the default parameters of each program can be used (see http://www.ncbi.nlm.nih.gov).
[200] The invention also provides a PCIP chimeric or fusion protein. As used herein, the term PCIP “chimeric protein” or “fusion protein” includes a PCIP polypeptide that is operably linked to a non-PCIP polypeptide. "PCIP polypeptide" refers to a polypeptide having an amino acid sequence corresponding to PCIP, whereas a "non-PCIP polypeptide" is different from a protein that is not substantially identical to a PCIP protein, eg, a PCIP protein. Reference is made to a polypeptide having an amino acid sequence corresponding to a protein derived from the same or different organism. Within the PCIP fusion protein, the PCIP polypeptide may correspond to all or part of the PCIP protein. In a preferred embodiment, the PCIP fusion protein comprises one or more biologically active moieties of the PCIP protein. In another preferred embodiment, the PCIP fusion protein comprises two or more biologically active portions of the PCIP protein. Within the fusion protein, the term "operably linked" is intended to indicate that the PCIP polypeptide and the non-PCIP polypeptide are fused in-frame with respect to each other. Non-PCIP polypeptides are fused to the N-terminus or C-terminus of the PCIP polypeptide.
[201] For example, in one embodiment, the fusion protein is a GST-PCIP fusion protein in which the PCIP sequence is fused to the C-terminus of the GST sequence. Such fusion proteins can facilitate the purification of recombinant PCIP.
[202] In another embodiment, the fusion protein is a PCIP protein containing a heterologous signal sequence at its N-terminus. In certain host cells (eg, mammalian host cells), expression and / or secretion of PCIP can be increased by using heterologous signal sequences.
[203] The PCIP fusion protein of the invention can be incorporated into pharmaceutical compositions and administered in vivo in a subject. PCIP fusion proteins can be used to influence the bioavailability of PCIP substrates. The use of PCIP fusion proteins may be used in potassium channel related diseases such as CNS diseases, such as Alzheimer's disease, dementia associated with Alzheimer's disease (eg, Pick's disease), Parkinson's disease and other Louis diffuse body disease, multiple sclerosis Neurodegenerative diseases such as amyotrophic lateral sclerosis, advanced nuclear palsy, epilepsy, spinal cerebellar ataxia, and Creutzfeldt-Jakob disease; Psychiatric disorders such as depression, schizophrenic disorders, Korsakoff mental illness, mania, anxiety disorders or fear disorders; Learning or memory disorders such as amnesia or age related memory loss; And neurological disorders such as migraine headaches. The use of PCIP fusion proteins can also be used in potassium channel related disorders such as cardiovascular disorders such as atherosclerosis, ischemia reperfusion injury, restenosis, arterial inflammation, vasculature remodeling, ventricular remodeling, ventricular palatation, coronary micro It may be useful for therapeutic purposes to treat coronary microembolism, tachycardia, bradycardia, pressure overload, aortic arch, coronary artery ligation, vascular heart disease, atrial fibrillation or congestive heart failure.
[204] Moreover, the PCIP fusion proteins of the present invention can be used as immunogens to generate anti-PCIP antibodies to subjects, can be used to purify PCIP ligands, and screening assays to identify molecules that inhibit the interaction of PCIP substrates with PCIP substrates. Can be used for
[205] Preferably, the PCIP chimeric or fusion proteins of the invention are produced by standard recombinant DNA techniques. For example, DNA fragments encoding different polypeptide sequences may be prepared according to conventional techniques, for example, at the ends of the linking smooth or stagger ends, restriction enzyme digestion to provide suitable ends, adhesion where appropriate. It is bound together in-frame by the use of internal end charge, alkaline phosphatase to avoid unwanted binding, and enzymatic binding. In another embodiment, the fusion gene can be synthesized by conventional techniques including automated DNA synthesizers. Alternatively, PCR amplification of the gene fragment can be accomplished using anchor primers that generate complementary overhangs between two consecutive gene fragments that can subsequently be annealed and reamplified to generate the chimeric gene sequence. Can be performed. See, eg, Current Protocols in Molecular Biology , eds. Ausubel et al . John Wiley & Sons: 1992]. Moreover, many expression vectors are available that are pre-coded fusion moieties (eg, GST polypeptides). PCIP encoding nucleic acids can be cloned into such expression vectors so that the fusion moiety can be linked in-frame to the PCIP protein.
[206] The invention also relates to mutants of PCIP proteins that function as PCIP agonists (analogs) or PCIP antagonists. Mutants of the PCIP protein may be generated by mutagenesis of the PCIP protein, eg, split point mutation or truncation. The agent of the PCIP protein may have substantially the same or a subset of the biological activity of the native PCIP protein. Antagonists of PCIP proteins can inhibit one or more activities of native PCIP proteins, for example by competitively regulating the potassium channel mediated activity of PCIP proteins. As such, certain biological effects can be induced by treatment with mutants of limited function. In one embodiment, treatment of the subject with a mutant having a subset of the biological activity of the above-described protein of the native type causes fewer side effects to the subject as compared to treatment with the native PCIP protein.
[207] In one embodiment, a mutant of a PCIP protein that functions as a PCIP agonist (analog) or a PCIP antagonist is screened by screening a mutant, eg, a combinatorial library of PCIP proteins for PCIP protein agonist or antagonist activity. Can be identified. In one embodiment, the mutated library of PCIP mutants is generated by combinatorial mutagenesis at the nucleic acid level and encoded by the mutated gene library. Mutated libraries of PCIP mutants, for example, enzymatically bind a mixture of synthetic oligonucleotides to a gene sequence such that a degenerate set of potential PCIP sequences is replaced by an individual polypeptide, or alternatively, a set of PCIP sequences. By making it expressible as a subset of larger fusion proteins contained therein (eg, for phage display). There are a variety of methods that can be used to generate libraries of potential PCIP mutants from degenerate oligonucleotide sequences. Chemical synthesis of degenerate gene sequences can be performed in an automated DNA thinser, and the synthetic genes are then incorporated into appropriate expression vectors. The use of degenerate sets of genes allows all of the sequences encoding the desired set of potential PCIP sequences to be provided in one mixture. Methods of synthesizing degenerate oligonucleotides are known in the art. See, eg, Narang, SA (1983) Tetrahedron 39: 3; Itakura et al . (1984) Annu. Rev. Biochem . 53: 323; Itakura et al . (1984) Science 198: 1056; Ike et al . (1983) Nucleic Acid Res . 11: 477].
[208] In addition, libraries of fragments of PCIP protein coding sequences can be used to generate mutated populations of PCIP fragments for screening and subsequent selection of mutants of PCIP proteins. In one embodiment, a library of coding sequence fragments is treated with a double stranded PCR fragment of a PCIP coding sequence with a nuclease under conditions where cleavage occurs only about once per molecule, denaturing the double stranded DNA, and denatured DNA. Generate double-stranded DNA, which may include sense / antisense pairs from different cleaved products, remove single-stranded portions from the double-formed reconstructed by treatment with S1 nuclease, and add the resulting fragment library to the expression vector. Can be generated by binding. By this method, expression libraries can be derived which encode the N-terminus, C-terminus and internal fragments of PCIP proteins of various sizes.
[209] Several techniques are known in the art for screening gene products of combinatorial libraries made by point mutations or cleavage and for screening cDNA libraries for gene products with selected properties. This technique may be suitable for rapid screening of gene libraries generated by combinatorial mutagenesis of PCIP proteins. The most widely used techniques for screening large gene libraries that can be analyzed at high throughput are cloning the gene libraries into replicable expression vectors, transforming the appropriate cells with the generated vector library, and detecting the desired activity. Expressing the combination gene under conditions that facilitate the isolation of the vector encoding the gene from which the product of the gene is detected. Recombinant ensemble mutagenesis (REM), a new technique for increasing the frequency of functional mutants in libraries, can be used in conjunction with screening assays to identify PCIP mutants [Arkin and Yourvan (1992). ) Proc. Natl. Acad. Sci. USA 89: 7811-7815; Delgrave et al . (1993) Protein Engineering 6 (3): 327-331.
[210] In one embodiment, the cell based assay can be used to analyze the mutated PCIP library. For example, a library of expression vectors can be transfected into cell lines that normally have potassium channel mediated activity. The effect of PCIP mutants on potassium channel mediated activity can then be identified, for example, by any of a number of enzyme assays or by detecting the release of neurotransmitters. The plasmid DNA can then be recovered from the cells scored for inhibition or enhancement of potassium channel mediated activity, and further individual clones characterized.
[211] Isolated PCIP proteins, or portions or fragments thereof, can be used as immunogens to generate antibodies that bind to PCIP using standard techniques for preparing polyclonal and monoclonal antibody preparations. Full length PCIP proteins may be used or, alternatively, the present invention provides antigenic peptide fragments of PCIP for use as immunogens. Antigenic peptides of PCIP include SEQ ID NO: 2, SEQ ID NO: 4, SEQ ID NO: 6, SEQ ID NO: 8, SEQ ID NO: 10, SEQ ID NO: 12, SEQ ID NO: 14, SEQ ID NO: 16, SEQ ID NO: 18, SEQ ID NO: 20, SEQ ID NO: 22, SEQ ID NO: 24, SEQ ID NO: 26, SEQ ID NO: 28, SEQ ID NO: 30, SEQ ID NO: 32, SEQ ID NO: 34, SEQ ID NO: 36, SEQ ID NO: 38, SEQ ID NO: 40, SEQ ID NO: 49, SEQ ID NO: 51, SEQ ID NO: 53, SEQ ID NO: 55, SEQ ID NO: 57, SEQ ID NO: 59, SEQ ID NO: 70, SEQ ID NO: 72, SEQ ID NO: 76, SEQ ID NO: 78, SEQ ID NO: 81, SEQ ID NO: 83, SEQ ID NO: 85, SEQ ID NO: 87, SEQ ID NO: 89, SEQ ID NO: 91, SEQ ID NO: 93, SEQ ID NO: 95, SEQ ID NO: 97, SEQ ID NO: 99, SEQ ID NO: An epitope of PCIP comprising at least 8 amino acid residues of the amino acid sequence shown in 101, SEQ ID NO: 103, or SEQ ID NO: 109, such that the antibody generated against the peptide forms a specific immune complex with PCIP. Include. Preferably, the antigenic peptide comprises at least 10 amino acid residues, more preferably at least 15 amino acid residues, even more preferably at least 20 amino acid residues, most preferably at least 30 amino acid residues.
[212] Preferred epitopes comprised by antigenic peptides are regions of PCIP, such as hydrophilic regions, and regions of high antigenicity located on the surface of the protein.
[213] PCIP immunogens are typically used to prepare antibodies by immunizing a suitable subject (eg, rabbit, goat, mouse or other mammal) with an immunogen. Suitable immunogenic preparations may contain, for example, recombinantly expressed PCIP proteins or chemically synthesized PCIP polypeptides. Such preparations may further comprise adjuvant, such as Freund's complete or incomplete immune adjuvant, or similar immunostimulant. Immunization of suitable subjects by immunogenic PCIP preparations results in polyclonal anti-PCIP antibody responses.
[214] Accordingly, another aspect of the invention relates to anti-PCIP antibodies. The term "antibody" as used herein contains an immunoglobulin molecule and an immunologically active portion of an immunoglobulin molecule, i.e., an antigen binding site that specifically binds to an antigen, such as PCIP (which specifically produces an immune response with the antigen). Reference molecules. Examples of immunologically active portions of immunoglobulin molecules include F (ab) and F (ab ') ₂ fragments that can be produced by treating the antibody with an enzyme such as pepsin. The present invention provides polyclonal and monoclonal antibodies that bind to PCIP. As used herein, the term “polyclonal antibody” or “monoclonal antibody composition” refers to a population of antibody molecules containing only one type of antigen binding site capable of immunoreacting with a particular epitope of PCIP. Typically monoclonal antibody compositions exhibit a single binding affinity for certain PCIP proteins that elicit an immune response.
[215] Polyclonal anti-PCIP antibodies can be prepared as described above by immunizing a suitable subject with a PCIP immunogen. Anti-PCIP antibody titers of immunized subjects can be monitored over time by standard techniques such as enzyme-linked immunosorbent assay (ELISA) using immunized PCIP. If desired, antibody molecules derived against PCIP can be isolated from mammals (eg from blood) and further purified by well known techniques such as protein A chromatography to obtain IgG fractions. have. At appropriate time points after immunization, for example, when anti-PCIP antibody titers are highest, antibody producing cells can be obtained from the subject, first described in Kohler and Milstein (1975) Nature 256: 495-497. Standard techniques, such as hybridoma techniques [see also Brown et al . (1981) J. Immunol. 127: 539-46; Brown et al . (1980) J. Biol. Chem . 255: 4980-83; Yeh et al . (1976) Proc. Natl. Acad. Sci. USA 76: 2927-31; and Yeh et al . (1982) Int. J. Cancer 29: 269-75], more recent human B cell hybridoma technology (Kozbor et al . (1983) Immunol Today 4:72], EBV-hybridoma technology [Ref. Cole et al . (1985) Monoclonal Antibodies and Cancer Therapy , Alan R. Liss, Inc., pp. 76-96 or trioma techniques can be used to prepare monoclonal antibodies. Techniques for generating monoclonal antibody hybridomas are well known [General Reference Examples: RH Kenneth, in Monoclonal Antibodies: A New Dimension In Biological Analyses , Plenum Publishing Corp. New York. New York (1980); EA Lerner (1981) Yale J. Biol. Med .. 54: 387-402; ML Gefter et al . (1977) Somatic Cell Genet . 3: 231-36. In brief, an endless growth cell line (typically myeloma cell line) is fused to lymphocytes (typically splenocytes) from a mammal immunized with a PCIP immunogen as described above, and the culture supernatant of the resulting hybridoma cells is transferred to PCIP. Screened to identify hybridomas that produce monoclonal antibodies that bind.
[216] All of the many known protocols used to fuse lymphocytes with endogenous cell lines can be applied for the purpose of generating anti-PCIP monoclonal antibodies. See, eg, G. Galfre et al . (1977) Nature 266: 55052; Gefter et al. Somatic Cell Genet. , Cited above; Lerner, Yale J. Biol. Med ., Cited above; Kenneth, Monoclonal Antibodies, cited above. Moreover, those skilled in the art will recognize that many variations of these methods may be usefully employed. Typically, endogenous cell lines (eg, myeloma cell lines) are derived from the same mammalian species as lymphocytes. For example, murine hybridomas can be produced by fusing lymphocytes from mice immunized with the immunogenic preparations of the present invention with an infinite growth mouse cell line. Preferred endogenous cell lines are mouse myeloma cell lines that are sensitive to culture medium (“HAT medium”) containing hypoxanthine, aminopterin and thymidine. All multiple myeloma cell lines can be used as fusion partners according to standard techniques, such as P3-NS1 / 1-Ag4-1, P3-x63-Ag8.653 or Sp2 / O-Ag14 myeloma cell lines. These myeloma cell lines are available from ATCC. Typically, HAT sensitive mouse myeloma cells are fused to mouse spleen cells using polyethylene glycol (“PEG”). The hybridoma cells resulting from fusion are then selected using HAT medium to kill myeloma cells that have been fused with non-fused myeloma cells (non-fused splenocytes die after several days because they are not transformed). . Hybridoma cells producing monoclonal antibodies of the invention are detected by screening the hybridoma culture supernatants against antibodies bound to PCIP, for example, using standard ELISA assays.
[217] As an alternative to making monoclonal antibody secreting hybridomas, monoclonal anti-PCIP antibodies screen for recombinant combinatorial immunoglobulin libraries (eg, antibody phage display libraries) with PCIP to produce immunoglobulins bound to PCIP. It can be identified and isolated by isolating library members. Kits for generating and screening phage display libraries are available [the Pharmacia Recombinant Phage Antibody System . Catalog No. 27-9400-01; And the Stratagene SurfZAP ™ Phage Display Kit . Catalog No. 240612]. In addition, examples of methods and reagents particularly suitable for use in generating and screening antibody display libraries are described, for example, in US Pat. No. 5,223,409 to Ladner et al .; PCT International Publication No. WO 92/18619 to Kang et al .; PCT International Publication No. WO 91/17271 to Dower et al .; PCT International Publication No. WO 92/20791 to Winter et al .; PCT International Publication No. WO 92/15679 to Markland et al .; PCT International Publication WO 93/01288 by Breitling et al .; PCT International Publication No. WO 92/01047 such as McCafferty; PCT International Publication No. WO 92/09690 to Garrard et al .; PCT International Publication No. WO 90/02809 to Radner et al .; And Fuchs et al . (1991) Bio / Technology 9: 1370-1372; Hay et al. (1992) Hum. Antibod. Hybridomas 3: 81-85; Huse et al. (1989) Science 246: 1275-1281; Griffiths et al . (1993) EMBO J 12: 725-734; Hawkins et al . (1992) J. Mol. Biol . 226: 889-896; Clarkson et al. (1991) Nature 352: 624-628; Gram et al. (1992) Proc. Natl. Acad. Sci. USA 89: 3576-3580; Garrad et al . (1991) Bio / Technology 9: 1373-1377; Hoogenboom et al. (1991) Nuc. Acid Res . 19: 4133-4137; Barbas et al . (1991) Proc. Natl. Acad. Sci. USA 88: 7978-7982; and McCafferty et al. Nature (1990) 348: 552-554.
[218] In addition, recombinant anti-PCIP antibodies, such as chimeric and humanized monoclonal antibodies, including both human and non-human portions, which can be generated using standard recombinant DNA techniques, are within the scope of the present invention. Such chimeric and print monoclonal antibodies are described in recombinant DNA techniques known in the art, such as in International Application No. PCT / US86 / 02269 to Robinson et al .; European Patent Application No. 184,187 to Akira et al .; European Patent Application No. 171,496 to Taniguchi, M .; European Patent Application No. 173,494 to Morrison et al .; PCT International Publication No. WO 86/01533 to Neuberger et al .; US Patent 4,816,567 to Cabilly et al .; European Patent Application No. 125,023 to Cavili et al .; And Better et al. (1988) Science 240: 1041-1043; Liu et al . (1987) Proc. Natl. Acad. Sci. USA 84: 3439-3443; Liu et al . (1987) J. Immunol. 139: 3521-3526; Sun et al . (1987) Proc. Natl. Acad. Sci. USA 84: 214-218; Nishimura et al . (1987) Canc. Res . 47: 999-1005; Wood et al . (1985) Nature 314: 446-449; and Shaw et al . (1988) J. Natl. Cancer Inst . 80: 1553-1559; Morrison. SL (1985) Science 229: 1202-1207; Oi et al. (1986) BioTechniques 4: 214; Winter US Patent 5,225,539; Jones et al . (1986) Nature 321: 552-525; Verhoeyan et al. (1988) Science 239: 1534; and Beidler et al . (1988) J. Immunol . 141: 4053-4060.
[219] Anti-PCIP antibodies (eg monoclonal antibodies) can be used to isolate PCIP by standard techniques such as affinity chromatography or immunoprecipitation. Anti-PCIP antibodies can facilitate the purification of recombinantly produced PCIP expressed in native PCIP and host cells from cells. Moreover, anti-PCIP antibodies can be used to detect PCIP proteins (eg in cell lysates or cell supernatants) to assess the pattern and abundance of the expression of PCIP proteins. Anti-PCIP antibodies can be used diagnostically to determine the effectiveness of a given therapy by monitoring protein levels in tissue as part of the clinical trial process. Detection can be facilitated by coupling (ie, physically binding) the antibody to a detectable component. Examples of detectable components include various enzymes, auxiliary groups, fluorescent materials, luminescent materials, bioluminescent materials and radioactive materials. Examples of suitable enzymes include horseradish peroxidase, alkaline phosphatase, alkaline galactosidase or acetylcholinesterase; Examples of suitable auxiliary group complexes include streptavidin / biotin and avidin / biotin; Examples of suitable fluorescent materials include umbelliferone, fluorescein, fluorescein isothiocyanate, rhodamine, dichlorotriazinylamine fluorescein, monochloro chloride or phycoerythrin; Examples of luminescent materials include luminol; Examples of bioluminescent materials include luciferase, luciferin, and aquorin; Examples of suitable radioactive materials include ¹²⁵ I, ¹³¹ I, ³⁵ S or ³ H.
[220] III. Recombinant Expression Vectors and Host Cells
[221] Another aspect of the invention relates to an expression vector containing a nucleic acid encoding a vector, preferably a PCIP protein (or a portion thereof). As used herein, the term "vector" refers to a nucleic acid molecule linked to another nucleic acid and capable of transporting another nucleic acid. One type of vector is a "plasmid" which refers to a circular double stranded DNA to which additional DNA segments can be linked. Another type of vector is a viral vector in which additional DNA segments can be linked to the viral genome. Certain vectors are capable of autonomous replication in the host cell into which they are introduced (eg bacterial vectors and episomal mammalian vectors with origins of bacterial replication). Other vectors (eg, non-episomal mammalian vectors) replicate with the host genome by integrating into the genome of the host cell upon introduction into the host cell. In addition, certain vectors may direct the expression of the genes to which they are operatively linked. Such vectors are referred to herein as "expression vectors". In general, expression vectors of utility in recombinant DNA techniques are often in the form of plasmids. In this specification, "plasmid" and "vector" can be used interchangeably because the plasmid is the vector of the most commonly used form. However, the present invention is meant to include such other forms of expression vectors, such as viral vectors (eg, replication defective retroviruses, adenoviruses, and adeno-associated viruses) that function equally.
[222] Recombinant expression vectors of the invention include nucleic acids of the invention in a form suitable for expression of nucleic acids in a host cell, wherein the recombinant expression vector is selected based on the host cell used for expression and is operable to the nucleic acid sequence to be expressed. It means that it comprises one or more regulatory sequences linked by. In a recombinant expression vector, "operably linked" means that the nucleotide sequence of interest is linked to a regulatory sequence in a manner that permits expression of the nucleotide sequence (e.g., in vitro transcription / translation system or In the host cell when the vector is introduced into the host cell). The term "regulatory sequence" is meant to include promoters, enhancers, and other expression control elements (eg, polyadenylation signals). Such regulatory sequences are described, for example, in Goeddel, Gene Expression Technology: Methods in Enzymology 185, Acadmic Press, San Diego, CA (1990). Regulatory sequences include those that direct constitutive expression of a nucleotide sequence in many types of host cells and those that direct expression of a nucleotide sequence only in a particular host cell (eg, tissue specific regulatory sequences). Those skilled in the art will appreciate that the design of the expression vector may depend on factors such as the choice of host cell to be transformed, the level of expression of the protein of interest, and the like. Expression vectors of the invention can be introduced into a host cell to produce a protein or peptide comprising a fusion protein or peptide encoded by the nucleic acids described herein (eg, PCIP protein, mutant forms of PCIP protein, fusion proteins). Etc).
[223] Recombinant expression proteins of the invention can be designed for expression of PCIP proteins in prokaryotic or eukaryotic cells. For example, the PCIP protein can be expressed in bacterial cells, such as E. coli, insect cells (using baculovirus expression vectors), yeast cells, or mammalian cells. Suitable host cells are also discussed in Goeddel, Gene Expression Technology: Methods in Enzymology 185, Acadmic Press, San Diego, CA (1990). Alternatively, the recombinant expression vector can be transcribed and translated in vitro using, for example, a T7 promoter regulatory sequence and a T7 polymerase.
[224] Protein expression in prokaryotes is most frequently performed in E. coli using vectors containing constitutive or inducible promoters that direct the expression of fusion or non-fusion proteins. Fusion vectors add many amino acids to the amino terminus of an encoded protein, typically a recombinant protein. Such fusion vectors typically serve three purposes: 1) increased expression of recombinant protein; 2) increased solubility of the recombinant protein; And 3) assisting in the purification of recombinant proteins by acting as ligands in affinity purification. Often, in fusion expression vectors, proteolytic cleavage sites are introduced at the junction of the fusion moiety and the recombinant protein to allow separation of the recombinant protein from the fusion moiety after purification of the fusion protein. Such enzymes, and their cognate recognition sequences, include Factor Xa, thrombin and enterokinase. Typical fusion expression vectors are pGEX (Pharmacia Biotech Inc .; Smith DB and Johnson, KS (1988) Gene), which respectively fuse glutathione S-transferase (GST), maltose E binding protein, or protein A to a target recombinant protein. 67: 31-40), pMAL (New England Biolabs, Beverly, Mass.) And pRIT5 (Pharmacia, Peaceaway, NJ).
[225] Purified fusion proteins can be used in PCIP activity assays (eg, direct assays or competitive assays described in detail below) or can be used, for example, to generate antibodies specific for PCIP proteins. In one preferred embodiment, the PCIP fusion protein expressed in the retroviral expression vector of the invention can be used to infect bone marrow cells subsequently transplanted into the irradiated recipients. After sufficient time has elapsed (eg, 6 weeks), a pathological examination of the recipient recipient, which is a subject, is performed.
[226] Examples of suitable inducible non-fusion E. coli vectors include pTrc (Amann et al., (1988) Gene 69: 301-315) and pET 11d (Studier et al., Gene Expression Technology: Methods in Enzymology 185, Academic Press, San Diego , California (1990) 60-89). Target gene expression from the pTrc vector is dependent on host RNA polymerase transcription from the hybrid trp-lac promoter. Target gene expression from the pET 11d vector is dependent on transcription from the T7 gn10-lac fusion promoter mediated by coexpressed viral RNA polymerase (T7 gn1). Such viral polymerases are provided by host strain BL21 (DE3) or HMS174 (DE3) from resident propages that hide the T7 gn1 gene under the transcriptional control of the lacUV 5 promoter.
[227] One way to maximize recombinant protein expression in Escherichia coli is to express the protein in a host bacterium that has been impaired in its ability to proteolytically cleave the recombinant protein. Gottesman, S., Gene Expression Technology: Methods in Enzymology 185, Academic Press , San Diego, California (1990) 119-128. Another method is to change the nucleic acid sequence of the nucleic acid to be inserted into the expression vector so that individual codons for each amino acid are those selectively used in E. coli. See, Wada et al., (1992) Nucleic Acids Res. 20: 2111-2118]. Such changes in nucleic acid sequences of the invention can be carried out by standard DNA synthesis techniques.
[228] In another embodiment, the PCIP expression vector is a yeast expression vector. Examples of expression vectors in yeast S. cervisae include pYepSec1 (Baldari et al., (1987) Embo J. 6: 229-234), pMFa (Kurjan and Herskowitz (1982) Cell 30: 933- 943, pJRY88 (Schultz et al., (1987) Gene 54: 113-123), pYES2 [Invitrogen Corporation, San Diego, Calif.], And picZ (InVitrogen Corp. San Diego, Calif.).
[229] Alternatively, PCIP proteins may be expressed in insect cells using baculovirus expression vectors. Baculovirus vectors usable for expression of proteins in cultured insect cells (eg, Sf 9 cells) have been described in the pAC family [Smith et al., (1983) Mol. Cell Biol. 3: 2156-2156 and the pVL series (Lucklow and Summers (1989) Virology 170: 31-39).
[230] In another embodiment, the nucleic acids of the invention are expressed in mammalian cells using mammalian expression vectors. Examples of mammalian expression vectors include pCDM8 [Seed, B. (1987) Nature 329: 840] and pMT2PC [Kaufman et al., (1987) EMBO J. 6: 187-195]. When used in mammalian cells, the expression vector's regulatory function is often provided by viral regulatory elements. For example, commonly used promoters are obtained from polyoma, adenovirus 2, cytomegalovirus and simian virus 40. For other expression systems suitable for both prokaryotic and eukaryotic cells, see Sambrook, J. Fritsh, EF, and Maniatis, T. Molecular Cloning: A Laboratory Manual 2nd, ed., Cold Spring Harbor Laboratory, Cold Spring Harbor Laboratory Press, Cold Spring Harbor Laboratory, NY Chapter 16 and 17 of 1989].
[231] In other embodiments, the recombinant mammalian expression vector is selectively indicative of expression of the nucleic acid in a particular cell type (eg, tissue specific regulatory elements are used to express the nucleic acid). Tissue specific regulatory elements are known in the art. Non-limiting examples of suitable tissue specific promoters include albumin promoter (liver specific; Pinkert et al. (1987) Genes Dev. 1: 268-277), lymphoid specific promoters (Calame and Eaton (1988) Adv. Immunol. 43: 235-275), in particular promoters of T cell receptors (Winoto and Baltimore (1989) EMBO J. 8: 729-733) and immunoglobulins (Banerji et al. (1983) Cell 33: 729-740; Queen and Baltimore (1983) Cell 33: 741-748), neuronal specific promoters (eg, neurofibrillary promoters; Byrne and Ruddle (1989) Proc. Natl. Acad. Sci. USA 86: 5473-5477), pancreatic specific promoters (Edlund et al., (1985) Science 230: 912-916) and milk gland specific promoters (eg, whey promoter; US Pat. No. 4,873,316 and European Application Publication No. 264,166). Developmentally regulated promoters, such as the murine hox promoter (Kessel and Gruss (1990) Science 249: 374-379) and the α-fetal protein promoter (Campes and Tilghman (1989) Genes Dev. 3: 537-546).
[232] The invention also provides a recombinant expression vector comprising a DNA molecule of the invention cloned into an expression vector in the antisense direction. That is, the DNA molecule is operatively linked to regulatory sequences in a manner that allows expression of the RNA molecule that is antisense to the PCIP mRNA (by transcription of the DNA molecule). The regulatory sequence operably linked to the nucleic acid cloned in the antisense direction may be selected as those that direct the continuous expression of the antisense RNA molecule in various cell types, for example viral promoters and / or amplification agents, or the regulatory sequence may be antisense And those that direct constitutive, tissue specific or cell type specific expression of RNA. Antisense expression vectors can be in the form of recombinant plasmids, phagemids or attenuated viruses, in which antisense nucleic acids are produced under the control of a highly efficient regulatory region, the activity of which can be determined by the cell type into which the vector is introduced. . For a discussion of the regulation of gene expression using antisense genes, see the following references: Weintraub, H. et al., Antisense RNA as a molecular tool for genetic analysis, Reviews-Trends in Genetics, Vol. 1 (1) 1986].
[233] Another aspect of the invention relates to a host cell into which the recombinant expression vector of the invention has been introduced. The terms “host cell” and “recombinant host cell” are used interchangeably herein. This term, of course, refers to the progeny or potential progeny of such cells as well. Since specific modifications may occur in the next generation due to mutations or environmental influences, these progeny may not be virtually identical to the parent cell, but are included within the scope of the term as used herein.
[234] The host cell can be any prokaryotic or eukaryotic cell. For example, PCIP proteins can be expressed in bacterial cells, such as E. coli, yeast or mammalian cells (eg, Chinese hamster ovary cells (CHO) or COS cells). Other suitable host cells are known to those skilled in the art.
[235] Vector DNA can be introduced into prokaryotic or eukaryotic cells by conventional transformation or transfection techniques. As used herein, the terms “transformation” and “transfection” are meant to refer to a variety of known techniques for introducing foreign nucleic acids (eg, DNA) into host cells, including calcium phosphate or calcium chloride co-precipitation, DEAE-dextran mediated transfection, lipofection, or electroporation is included. Suitable methods for transforming or transfecting host cells can be found in the following literature and in other experimental manuals: Sambrook et al., Molecular Cloning: A Laboratory Manual 2nd ed., Cold Spring Harbor Laboratory, Cold Spring Harbor Laboratory Press, Cold Spring Harbor Laboratory, NY 1989].
[236] For stable transfection of mammalian cells, it is known that only a small fraction of cells can integrate foreign DNA into their genome, depending on the expression vector and transfection technique used. To identify and select such components, it is common to introduce genes encoding selection markers (eg, resistant to antibiotics) into the host cell along with the gene of interest. Preferred selection markers include those that confer resistance to agents such as G418, hygromycin and methotrexate. The nucleic acid encoding the selection marker can be introduced into the host cell on the same vector as encoding the PCIP protein, or can be introduced on a separate vector. Cells stably transfected with the introduced nucleic acid can be identified by drug selection (eg, cells incorporating the selectable marker gene survive, but other cells die).
[237] Host cells of the invention, for example prokaryotic or eukaryotic host cells in culture, can be used to produce (ie, express) PCIP proteins. Thus, the present invention further provides a method of producing PCIP protein using the host cell of the present invention. In one embodiment, the method comprises culturing the host cell of the present invention (which contains a recombinant expression vector encoding a PCIP protein) in a suitable medium to produce the PCIP protein. In another embodiment, the method further comprises separating the PCIP protein from the medium or host cell.
[238] The host cell of the invention can also be used to produce nonhuman transgenic animals. For example, in one embodiment, the host cell of the invention is a modified oocyte or embryonic stem cell into which a PCIP coding sequence has been introduced. Such host cells can be used to make non-human transgenic animals in which exogenous PCIP sequences have been introduced into the genome or to homologous recombinant animals in which endogenous PCIP sequences have been modified. Such animals are useful for studying the function and / or activity of PCIP and for identifying and / or evaluating modulators of PCIP activity. As used herein, a “transgenic animal” is a non-human animal, preferably a rodent such as a mammal, more preferably a rat or a mouse, and at least one of said animal cells comprises a transgene. Other examples of transgenic animals include nonhuman primates, sheep, dogs, cattle, goats, chickens, amphibians, and the like. Transgenes are exogenous DNA integrated into the genome of a cell, from which the transgenic animal develops and remains in the genome of a mature animal, thereby directing the expression of the encoded gene product in one or more cell types or tissues of the transgenic animal. do. As used herein, a "homologous recombinant animal" is a non-human animal, preferably a mammal, more preferably a mouse, and prior to the development of the animal, the endogenous PCIP gene is applied to the endogenous gene and to the cells of the animal, such as embryonic cells of the animal. It is modified by homologous recombination between introduced exogenous DNA molecules.
[239] The transgenic animals of the present invention are made by introducing PCIP encoding nucleic acid into the male pronucleus of fertilized oocytes, for example by microinjection, retroviral infection, and developing oocytes in fertility female foster animals. Can be. SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 5, SEQ ID NO: 7, SEQ ID NO: 9, SEQ ID NO: 11, SEQ ID NO: 13, SEQ ID NO: 15, SEQ ID NO: 17, SEQ ID NO: 19, SEQ ID NO: 21, SEQ ID NO: 23, SEQ ID NO: 25, SEQ ID NO: 27, SEQ ID NO: 29, SEQ ID NO: 31, SEQ ID NO: 33, SEQ ID NO: 35, SEQ ID NO: 37, SEQ ID NO: 39, SEQ ID NO: 48, SEQ ID NO: 50, SEQ ID NO: 52, SEQ ID NO: 54, SEQ ID NO: 56, SEQ ID NO: 58, SEQ ID NO: 69, SEQ ID NO: 71, SEQ ID NO: 74, SEQ ID NO: 75, SEQ ID NO: 77, SEQ ID NO: 79, SEQ ID NO: 80, SEQ ID NO: 82, SEQ ID NO: 84, SEQ ID NO: 86, SEQ ID NO: 88, SEQ ID NO: 90, SEQ ID NO: 92, SEQ ID NO: 94, SEQ ID NO: 96, SEQ ID NO: 98, SEQ ID NO: 100, or the PCIP cDNA sequence of SEQ ID NO: 102 can be introduced into the genome of a non-human animal as a transgene. In addition, nonhuman homologues of the human PCIP gene, such as the mouse or rat PCIP gene, can be used as the transgene. In addition, PCIP gene homologs, such as other PCIP family members, include SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 5, SEQ ID NO: 7, SEQ ID NO: 9, SEQ ID NO: 11, SEQ ID NO: 13, SEQ ID NO: 15, SEQ ID NO: 17, SEQ ID NO: 19, SEQ ID NO: 21, SEQ ID NO: 23, SEQ ID NO: 25, SEQ ID NO: 27, SEQ ID NO : 29, SEQ ID NO: 31, SEQ ID NO: 33, SEQ ID NO: 35, SEQ ID NO: 37, SEQ ID NO: 39, SEQ ID NO: 46, SEQ ID NO: 47, SEQ ID NO: 48 , SEQ ID NO: 50, SEQ ID NO: 52, SEQ ID NO: 54, SEQ ID NO: 56, SEQ ID NO: 58, SEQ ID NO: 69, SEQ ID NO: 71, SEQ ID NO: 74, SEQ ID NO: 75, SEQ ID NO: 77, SEQ ID NO: 79, SEQ ID NO: 80, SEQ ID NO: 82, SEQ ID NO: 84, SEQ ID NO: 86, SEQ ID NO: 88, SEQ ID NO : 90, SEQ ID NO: 92, SEQ ID NO: 94, SEQ ID NO: 96, SEQ ID NO: 98, SEQ ID NO: 100, or PCIP cDNA sequence of SEQ ID NO: 102 or Accession No. 98936, 98937, 98938 DNA insertion sequences of plasmids deposited in ATCC as 98939, 98940, 98941, 98942, 98943, 98944, 98945, 98946, 98947, 98948, 98949, 98950, 98951, 98991, 98993 or 98994 (in addition to subsection I above) Are isolated on the basis of hybridization with that described) it can be used as a transgene. Intron sequences and polyadenylation signals can also be included in the transgene to increase the expression efficiency of the transgene. Tissue-specific regulatory sequence (s) can be operably linked to a PCIP transgene to allow expression of the PCIP protein for a particular cell. Methods of producing transgenic animals, particularly mice such as mice, via embryo manipulation and microinjection have become common in the art, for example, see US Pat. Nos. 4,736,866 and 4,870,009, Wagner (Leder et al.). Wagner et al., US Pat. No. 4,873,191 and Hogan, B., Manipulating the Mouse Embryo, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY, 1986. Similar methods were used to generate other transgenic animals. Transgenic founder animals can be identified based on the presence of a PCIP transgene in the genome and / or expression of PCIP mRNA in tissue or cells of the animal. The transgenic founder animal can then be used to give birth to additional animals carrying the transgene. In addition, transgenic animals carrying a transgene encoding a PCIP protein may be further bred into other transgenic animals carrying other transgenes.
[240] To produce homologous recombinant animals, the vectors are prepared to contain at least a portion of the PCIP gene in the vector to change, eg, functionally disrupt, the PCIP gene by introducing deletions, additions or substitutions. The PCIP gene may be a human gene (eg, cDNA of SEQ ID NO: 1), but more preferably, it is a non-human homologue of the human PCIP gene (eg SEQ ID NO: 3 or 5). For example, mouse PCIP genes can be used to construct homologous recombination vectors suitable for altering endogenous PCIP genes in the mouse genome. In a preferred embodiment, the vector is designed such that the endogenous PCIP gene is functionally disrupted upon homologous recombination (ie, it no longer encodes a functional protein; referred to as a "knock out" vector). In addition, the vector can be designed to encode functional proteins that are still mutated or otherwise altered in homologous recombination but still function (eg, changes in upstream regulatory regions can alter the expression of endogenous PCIP proteins). . In homologous recombination vectors, the altered portion of the PCIP gene is flanked 5 'and 3' by the additional nucleic acid sequence of the PCIP gene so that homologous recombination is carried by the vector between the exogenous PCIP gene and the endogenous PCIP gene in embryonic stem cells. Get up. Additional flanking PCIP nucleic acid sequences are of sufficient length for successful homologous recombination with endogenous genes. Typically, several kb of flanking DNA (both at the 5 'and 3' ends) are included in the vector (see the following reference for description of homologous recombination vectors: Thomas, K.R. and Capecchi, M. R. (1987) Cell 51: 503]. The vector is introduced into a germ stem cell line (eg, by electroporation) and cells in which the introduced PCIP gene is homologously recombined with the endogenous PCIP gene are selected. See Li, E. et al. (1992) Cell 69: 915. Selected cells are then introduced into the blastocysts of animals (eg, mice) to form aggregated chimeras. Bradley, A. in Teratocarcinomas and Embryonic Stem Cells: A Practical Approach, E.J. Robertson, ed. (IRL, Oxford, 1987) pp. 113-152). The chimeric embryo is then implanted in a suitable fertility female foster animal so that the embryo is maintained for a certain period of time. Progeny that carry homologous recombination DNA in embryonic cells can be used to breed an animal in which all cells of the animal contain homologous recombination DNA by embryonic cell line delivery of the transgene. Methods for constructing homologous recombinant animals and homologous recombinant vectors are described by Bradley, A. (1991) Current Opinion in Biotechnology 2: 823-829 and PCT International Publication Nos .: WO 90/11354 by Le Mouellec et al .; WO 91/01140 by Smithies et al .; WO 92/0968 by Zijlstra et al .; and WO 93/04169 by Berns et al.
[241] In another embodiment, an animal other than the transgenic human can be generated to contain a selected system that allows for controlled expression of the transgene. One example of such a system is the cre / loxP recombinase system of bacteriophage P1. For a description of the cre / loxP recombinase system, see Lakso et al. (1992) Proc. Natl. Acad. Sci. USA 89: 6232-6236. Another example of a recombinase system is the FLP recombinase system of Saccharomyces cerevisiae. O'Gorman et al. (1991) Science 251: 1351-1355. If the cre / loxP recombinase system is used to regulate the expression of the transgene, an animal containing a transgene encoding both the Cre recombinase and the selected protein is needed. Such animals are provided, for example, through the construction of "double" transgenic animals by crossing two transgenic animals, one containing the transgene encoding the selected protein and the other containing the transgene encoding the recombinant enzyme. Can be.
[242] Clones of non-human transgenic animals described herein are also described in Wilmut, I. et al. (1997) Nature 385: 810-813 and PCT International Publication Nos. It can be produced according to the method described in WO 97/07668 and WO 97/07669. In summary, cells from transgenic animals, such as somatic cells, can be isolated and induced out of the growth cycle and allowed to enter the G ₀ phase. The silent cells can then be fused with oocytes from which the nuclei from the same species of animal from which the silent cells were isolated, for example, using electrical pulses. The reconstituted oocytes are then cultured to develop into morula or cysts and then transferred to a fertility surrogate. Progeny of such surrogate mothers will be clones of isolated animals that have become cells, such as somatic cells.
[243] IV. Pharmaceutical composition
[244] PCIP nucleic acid molecules of the invention, fragments of PCIP proteins and anti-PCIP antibodies (also referred to herein as "active compounds") can be incorporated into pharmaceutical compositions suitable for administration. Such compositions typically comprise nucleic acid molecules, proteins or antibodies and pharmaceutically acceptable carriers. As used herein, “pharmaceutically acceptable carrier” includes any and all solvents, dispersion media, coatings, antibacterial and antifungal agents, isotonic and absorption delaying agents, and the like, suitable for pharmaceutical administration. The use of such media and agents for pharmaceutically active substances is well known in the art. Except insofar as any conventional media or agent is incompatible with the active compound, its use in the compositions is contemplated. Supplementary active compounds can also be incorporated into the compositions.
[245] Pharmaceutical compositions of the invention are formulated to be suitable for the intended route of administration. Examples of routes of administration include parenteral, such as intravenous, intradermal, subcutaneous, oral (eg inhalation), transdermal (topical), transmucosal and rectal administration. Solutions or suspensions used for parenteral, intradermal or subcutaneous application may include the following components: sterile diluents such as water for injection, saline, fixed oils, polyethylene glycols, glycerin, propylene glycol or other synthetic solvents; Antibacterial agents such as benzyl alcohol or methyl parabens; Antioxidants such as ascorbic acid or sodium bisulfite; Chelating agents such as ethylenediaminetetraacetic acid; Buffers such as acetates, citrates or phosphates and agents for the regulation of strains such as sodium chloride or dextrose. The pH can be adjusted with acids or bases, such as hydrochloric acid or sodium hydroxide. Parenteral preparations may be contained in ampoules, disposable syringes or multiple dose vials made of glass or plastic.
[246] Pharmaceutical compositions suitable for injection include sterile aqueous solutions (if water soluble) or dispersions and sterile powders for the instant preparation of sterile injectable solutions or dispersions. For intravenous administration, suitable carriers include physiological saline, bacteriostatic water, Cremophor EL ^™ (BASF, Parsippany, NJ) or phosphate buffered saline (PBS). In all cases, the composition must be sterile and fluid enough to be easily injected. It must be stable under the conditions of manufacture and storage and must be preserved against the contaminating action of microorganisms such as bacteria and fungi. The carrier may be a solvent or a dispersion medium containing, for example, water, ethanol, polyols (eg, glycerol, propylene glycol and liquid polyethylene glycols, etc.) and suitable mixtures thereof. Suitable fluidity can be maintained, for example, by the use of a coating such as lecithin, by the maintenance of the required particle size in the case of dispersion, and by the use of surfactants. Prevention of microbial action can be achieved by various antibacterial and antifungal agents such as pariben, chlorobutanol, phenol, ascorbic acid, thimerosal and the like. In many cases, it is desirable to include isotonic agents, such as sugars, polyalcohols such as mannitol, sorbitol, sodium chloride in the composition. Prolonged absorption of the injectable compositions can be achieved by including agents which delay absorption in the composition, such as aluminum monostearate and gelatin.
[247] Sterile injectable solutions can be prepared by incorporating the required amount of active compound (eg, a fragment of a PCIP protein or an anti-PCIP antibody) alone or in combination with a combination of the ingredients listed above in a suitable solvent, followed by filtered sterilization, if necessary. Can be prepared. Generally, dispersions are prepared by incorporating the active compound into a sterile vehicle which contains a basic dispersion medium and the required other ingredients from those enumerated above. In the case of sterile powders for the preparation of sterile injectable solutions, preferred methods of preparation are vacuum drying and freeze-drying which produce a powder of any additional desired ingredient from the previously sterile-filtered solution with the active ingredient.
[248] Oral compositions generally include an inert diluent or an edible carrier. They may be surrounded by gelatin capsules or compressed into tablets. For oral therapeutic administration, the active compounds can be incorporated with excipients and used in the form of tablets, intraoral tablets or capsules. Oral compositions can also be prepared using a fluid carrier for use as a mouthwash, wherein the compound in the fluid carrier is applied orally, swished, spit or swallowed. Pharmaceutically suitable binders and / or adjuvant materials may be included as part of the composition. Tablets, pills, capsules, oral tablets and the like may contain any of the following components or compounds of similar nature: binders such as microcrystalline cellulose, gum tragacanth or gelatin; Excipients such as starch or lactose, disintegrating agents such as alginic acid, primogel or corn starch; Lubricants such as magnesium stearate or steotes; Lubricants such as colloidal silicon dioxide; Sweetening agents such as sucrose or saccharin; Or flavoring agents such as peppermint, methyl salicylate or orange flavoring.
[249] For administration by inhalation, the compound is delivered in the form of an aerosol spray from a pressurized vessel or disperser, or nebulizer, containing a suitable propellant such as gas such as carbon dioxide.
[250] Systemic administration can also be carried out by transmucosal or transdermal means. For transmucosal or transdermal administration, penetrants suitable for the barrier to be permeated are used during the formulation. Such penetrants are generally known in the art and include, for example, surfactants, bile salts and fusidic acid derivatives for transmucosal administration. Transmucosal administration can be performed using nasal sprays or suppositories. For percutaneous administration, the active compounds are formulated in ointments, plasters, gels or creams as is generally known in the art.
[251] The compounds may also be prepared in the form of suppositories (such as with conventional suppository bases such as cocoa butter and other glycerides) or retention enemas for delivery via the rectum.
[252] In one embodiment, the active compound is prepared with a carrier that will protect the compound against rapid removal from the body, such as a controlled release formulation, including implanted and microencapsulated delivery systems. Biodegradable, biocompatible polymers can be used, such as ethylene vinyl acetate, polyanhydrides, polyglycolic acid, collagen, polyorthoesters, and polylactic acid. Methods of preparing such formulations will be apparent to those skilled in the art. The materials can also be obtained for use from Alza Corporation and Nova Pharmaceuticals, Inc. Liposomal suspensions (including liposomes targeted against infected cells with monoclonal antibodies to viral antigens) can also be used as pharmaceutically acceptable carriers. These can be prepared according to methods known to those skilled in the art, for example as described in US Pat. No. 4,522,811.
[253] Particular preference is given to formulating oral or parenteral compositions in unit dosage form for ease of administration and constant dosage. As used herein, unit dosage form refers to physically discrete units suited as single doses to the subjects to be treated; Each unit containing a predetermined amount of active compound is calculated with the required pharmaceutical carrier to produce the desired therapeutic effect. The details of the unit dosage form of the present invention are defined and directly defined by the unique characteristics of the active compounds for the treatment of the individual, the specific therapeutic effect to be achieved and the limitations inherent in the art of making such active compounds. Depends.
[254] Toxicity and therapeutic efficacy of such compounds can be determined by measuring standard pharmaceutical procedures in cell culture or laboratory animals, such as LD50 (a dose that kills 50% of the population) and ED50 (a therapeutically effective dose on 50% of the population). Can be determined. The dose ratio between toxic and therapeutic effects is the therapeutic index and it can be expressed as the ratio LD50 / ED50. Preferred are compounds that exhibit a large therapeutic index. Although compounds exhibiting toxic side effects can be used, care must be taken to design a delivery system in which the compound targets the affected tissue site to minimize side effects by reducing potential damage to unhepatitised cells.
[255] Data obtained from cell culture assays and animal studies can be used to formulate a range of dosages for use in humans. The range of dosage of such compounds is preferably within the range of circulating concentrations comprising ED50 with little or no toxicity. The dosage may vary within this range depending upon the dosage form employed and the route of administration utilized. For any compound used in the methods of the invention, the therapeutically effective amount can be estimated initially from cell culture assays. The dose may be formulated to achieve a circulating plasma concentration range that includes the IC50 (ie, the concentration of test compound that inhibits up to half of the symptoms in an animal model) as determined in cell culture. This information can be used to more accurately determine the dose available to humans. Plasma concentrations can be measured, for example, by high performance liquid chromatography.
[256] As defined herein, a therapeutically effective amount (ie, an effective dose) of a protein or polypeptide is about 0.001 to 30 mg, preferably about 0.01 to 25 mg, more preferably 0.1 to 20 mg, more preferably per kg of body weight. Preferably about 1 to 10 mg, 2 to 9 mg, 3 to 8 mg, 4 to 7 mg, or 5 to 6 mg. Those skilled in the art will appreciate that certain factors, including but not limited to the severity of the disease or condition, previous treatment, the general health and / or age of the subject, and other disease states, may affect the dosage required to effectively treat a subject. I will understand that. In addition, treatment of a subject with a therapeutically effective amount of a protein, polypeptide or antibody may comprise a single treatment, or preferably a series of treatments.
[257] In a preferred embodiment, the subject is about 0.1-20 per kg of body weight for about 1 to 10 weeks, preferably 2 to 8 weeks, more preferably about 3 to 7 weeks, more preferably about 4, 5 or 6 weeks. treated with mg of antibody, protein or polypeptide. It will also be appreciated that the effective amount of antibody, protein or polypeptide used for treatment may be increased or decreased over a particular course of treatment. Changes in dosage can be evident and determined from the results of the diagnostic assay as described herein.
[258] The present invention includes agents that modulate expression or activity. The agent can be, for example, a small molecule. For example, such small molecules include peptides, peptidomimetic, amino acids, amino acid analogs, polynucleotides, polynucleotide analogues, nucleotides, nucleotide analogues, organic or inorganic compounds having a molecular weight of less than about 10,000 grams per mole (i.e., hetero Organic or inorganic compounds having a molecular weight of less than about 5,000 grams per mole, organic or inorganic compounds having a molecular weight of less than about 1,000 grams per mole, less than about 500 grams per mole Organic or inorganic compounds having a molecular weight of and salts, esters and other pharmaceutically acceptable forms of such compounds.
[259] Appropriate amounts of small molecule agents are understood to depend on numerous factors in the knowledge of the physician, veterinarian or researcher. Dosages of small molecules vary, for example, depending on the identity, size and condition of the subject or treated sample, additional routes of administration of the composition to be administered, and, if possible, the effect the practitioner desires on the small molecule for the nucleic acid or polypeptide of the invention. something to do.
[260] Typical doses include one milligram or one microgram of small molecules per kilogram of subject or sample (eg, about 1 microgram per kilogram to about 500 milligrams per kilogram, about 100 micrograms per kilogram per kilogram About 5 milligrams, or 1 microgram per kg to about 50 micrograms per kg). It is further understood that the appropriate amount of small molecule depends on the efficacy of the small molecule for the expression or activity to be regulated. Such suitable doses can be determined using the assays described herein. If one or more of these small molecules is to be administered to an animal (eg, human) to modulate the expression or activity of a polypeptide or nucleic acid of the invention, for example, a doctor, veterinarian or researcher may first prescribe a relatively low dose and respond appropriately. The dose may subsequently be increased until this is produced, and the specific dose concentration for any particular animal subject may be determined by the specific compound used, age, weight, general health, sex and diet, time of administration, It is understood that it will depend on various factors including the route of administration, rate of secretion, any drug combination, and the degree of expression or activity to be regulated.
[261] In addition, the antibody (or fragment thereof) may be conjugated with a therapeutic moiety such as a cytotoxin, therapeutic agent or radioactive metal ion. Cytotoxins or cytotoxic agents include any agent that is harmful to cells. Examples include Taxol, Cytokalacin B, Gramicidine D, Ethidium Bromide, Emethine, Mitomycin, Etoposide, Tenofoside, Vincristine, Vinblastine, Colchicine, Doxorubicin, Daunorubicin, Dihydroxy Anthracene dione, mitoxantrone, mitramycin, actinomycin D, 1-dehydrotestosterone, glucocorticoid, procaine, tetracaine, lidocaine, propranolol, and puromycin and analogs or analogs thereof. Therapeutic agents include antimetabolites (e.g. methotrexate, 6-mercaptopurine, 6-thioguanine, cytarabine, 5-fluorouracil decarbazine), alkylating agents (e.g. mechlorethamine, thioepachlorambucil, mel Palan, carmustine (BSNU) and romustine (CCNU), cyclotosamine, busulfan, dibromomannitol, streptozotocin, mitomycin C, and cis-dichlorodiamine platinum (II) (DDP) cisplatin), Anthracyclines (such as daunorubicin (formerly daunomycin) and doxorubicin), antibiotics (such as dactinomycin (formerly actinomycin), bleomycin, mitramycin and anthracycin (AMC)), and anti-mitotic Agents (eg, vincristine and vinblastine) include, but are not limited to.
[262] The conjugates of the present invention can be used to alter certain biological responses, and the drug moiety is not to be construed as limited to classical chemotherapeutic agents. For example, the drug moiety can be a protein or polypeptide having the desired biological activity. Such proteins include, for example, toxins such as abrin, lysine A, Pseudomonas exotoxin or diphtheria toxin; Proteins such as tumor necrosis factor, alpha-interferon, beta-interferon, nerve growth factor, platelet derived growth factor, tissue plasminogen activator; Or for example lymphokines, interleukin-1 ("IL-1"), interleukin-2 ("IL-2"), interleukin-6 ("IL-6"), granulocyte macrophage colony stimulating factor ("GM- CSF "), granulocyte colony stimulating factor (" G-CSF "), or other growth factors.
[263] Techniques for conjugating such therapeutic moieties to antibodies are well known [Arnon et al., "Monoclonal Antibodies For Immunotargeting Of Drugs In Cancer Therapy", in Monoclonal Antibodies And Cancer Therapy, Reisfeld et al. (eds.), pp. 243-56 (Alan R. Liss, Inc. 1985); Hellstrom et al., "Antibodies For Drug Delivery", in Controlled Drug Delivery (2nd Ed.), Robinson et al. (eds.), pp. 623-53 (Marcel Dekker, Inc. 1987); Thorpe, "Antibody Carriers Of Cytotoxic Agents In Cancer Therapy: A Review", in Monoclonal Antibodies '84: Biological And Clinical Applications, Pinchera et al. (eds.), pp. 475-506 (1985); "Analysis, Results, And Future Prospective Of The Therapeutic Use Of Radiolabeled Antibody In Cancer Therapy", in Monoclonal Antibodies For Cancer Detection And Therapy, Baldwin et al. (eds.), pp. 303-16 (Academic Press 1985), and Thorpe et al., "The Preparation And Cytotoxic Properties Of Antibody-Toxin Conjugates", Immunol. Rev., 62: 119-58 (1982). In addition, antibodies may be conjugated with secondary antibodies to form antibody heteroconjugates, as described in US Pat. No. 4,676,980 to Segal.
[264] The nucleic acid molecule of the present invention can be inserted into a vector and used as a gene therapy vector. Gene therapy vectors can be used, for example, by intravenous injection, topical administration (US Pat. No. 5,328,470) or stereotactic infusion [Chen et al. (1994) Proc. Natl. Acad. Sci. USA 91: 3054-3057. Gene Therapy Vectors Pharmaceutical preparations may include gene therapy vectors in acceptable diluents, or may include a slow release matrix in which a gene transport vehicle is embedded. In addition, where a complete gene transfer vector is generated intact from recombinant cells, eg, retroviral vectors, such pharmaceutical agents may comprise one or more cells that produce a gene delivery system.
[265] The pharmaceutical composition may be included in a container, pack or dispenser with instructions for administration.
[266] V. Uses and Methods of the Invention
[267] The nucleic acid molecules, proteins, protein analogs and antibodies described herein can be used in one or more of the following methods: a) screening assays; b) predictive medicine (eg, diagnostic assays, prognostic assays, monitoring clinical trials and pharmacogenetics); And c) methods of treatment (eg, therapeutic and prophylactic). As described herein, PCIP proteins of the invention have one or more of the following activities: (1) interact with (eg, bind to) potassium channel proteins or portions thereof; (2) modulate the phosphorylation status of potassium channel proteins or portions thereof; (3) can bind to calcium and act, for example, as a calcium dependent kinase. For example, potassium channels or G-protein coupled receptors are phosphorylated in a calcium-dependent manner; (4) binds to calcium, eg acts as a calcium dependent transcription factor; (5) modulate potassium channel mediated activity in cells (eg neurons or heart cells), for example, to have a beneficial effect on the cells; (6) modulate chromatin formation in cells, such as neurons or heart cells; (7) modulate small traffic and protein transport in cells, such as neurons or cardiac cells; (8) modulate cytokine signaling in cells, such as neurons or heart cells; (9) modulate the binding of the cellular cytoskeleton to potassium channel proteins or portions thereof; (10) modulate cellular proliferation; (11) modulate the release of neurotransmitters; (12) modulate membrane sensitivity; (13) affects the resting potential of the membrane; (14) adjust the waveform and frequency of the action potential; (15) modulating the threshold of excitation, eg, (1) modulating the activity of a potassium channel protein or portion thereof; (2) modulate the phosphorylation status of the potassium channel protein or portion thereof; (3) modulate the phosphorylation status of potassium channel or G-protein coupled receptors in a calcium-dependent manner; (4) binds to calcium and acts as a calcium dependent transcription factor; (5) modulating potassium channel mediated activity in cells (eg, neurons or heart cells), eg, to have a beneficial effect on the cells; (6) modulate chromatin formation in cells, such as neurons or heart cells; (7) modulate vesicle traffic and protein transport in cells, such as neurons or cardiac cells; (8) modulate cytokine signaling in cells, such as neurons or heart cells; (9) modulate binding of the cellular cytoskeleton with potassium channel proteins or portions thereof; (10) regulate cellular proliferation; (11) regulate the release of neurotransmitters; (12) modulate membrane sensitivity; (13) affects the resting potential of the membrane; (14) adjusting the waveform and frequency of action potentials; (15) can be used to adjust the threshold of stimulation.
[268] Isolated nucleic acid molecules of the invention, for example, express PCIP proteins (eg, via recombinant expression vectors in host cells in gene therapy), and PCIP mRNA (eg, in biological samples), as described further below. Or to detect genetic alterations in the PCIP gene and to modulate PCIP activity. PCIP proteins can be used to treat disorders characterized by insufficient or excess production of PCIP substrates or production of PCIP inhibitors. In addition, PCIP proteins are disorders characterized by insufficient production or overproduction of PCIP proteins or production of PCIP protein forms with reduced or abnormal activity compared to PCIP wild type proteins (eg, degenerative neurological disorders such as Alzheimer's disease, Alzheimer's disease). CNS disorders such as dementia (such as Peak disease), Parkinson's disease, other diffuse Lewis body disease, multiple sclerosis, amyotrophic lateral sclerosis, progressive nuclear palsy, epilepsy, spinal cerebellar ataxia, and Creutzfeldt-Jakob disease associated with the disease; Depression, schizophrenia, Korsakoff psychosis, mania, anxiety, bipolar affective disorders or phobias; learning or memory disorders such as amnesia or age-related memory loss; nervous system disorders such as migraine; pain such as hyperalgesia or musculoskeletal Disorders; spinal cord injury; seizures; and head trauma; or frozen node dysfunction, heart failure, hypertension Drugs to screen natural PCIP substrates and to control PCIP activity, as well as to treat cardiac fibrillation, atrial flutter, dilated cardiomyopathy, idiopathic cardiomyopathy, myocardial infarction, coronary artery disease, coronary artery spasm or arrhythmia) Or for screening compounds. In addition, the anti-PCIP antibodies of the invention can be used to detect and isolate PCIP proteins, modulate the bioavailability of PCIP proteins, and modulate PCIP activity.
[269] A. Screening Assay :
[270] The present invention, for example, candidate compounds that have a stimulatory or inhibitory effect on PCIP expression or PCIP activity, or which have a stimulatory or inhibitory effect on the expression or activity of a PCIP substrate, i.e., candidate compounds that bind to a PCIP protein, a test Provided are methods (also called "screening assays") for identifying compounds or agents (eg, peptides, peptidomimetic, small molecules, or other drugs).
[271] In one embodiment, the present invention provides assays for screening candidate or test compounds that are substrates or biologically active portions of PCIP proteins or polypeptides. In another embodiment, the present invention provides assays for screening candidate or test compounds that bind to or modulate the activity of a PCIP protein or polypeptide or biologically active portion thereof. Test compounds of the present invention can be obtained using any of a number of approaches with combinatorial library methods known in the art, including biological libraries; Spatially addressable parallel solid or solution phase libraries; Synthetic library methods requiring deconvolution; '1-bead 1-compound' library method; And synthetic library methods using affinity chromatography selection. Biological library approaches are limited to peptide libraries, but four other approaches can be applied to peptide, non-peptide oligomers or small molecule libraries of compounds. Lam, K. S. (1997) Anticancer Drug Des. 12: 145].
[272] Examples of methods for synthesizing molecular libraries can be found, for example, in the literature: DeWitt et al. (1993) Proc. Natl. Acad. Sci. U.S.A. 90: 6909; Erb et al. (1994) Proc. Natl. Acad. Sci. USA 91: 11422; Zuckermann et al. (1994). J. Med. Chem. 37: 2678; Cho et al. (1993) Science 261: 1303; Carrell et al. (1994) Angew. Chem. Int. Ed. Engl. 33: 2059; Carell et al. (1994) Angew. Chem. Int. Ed. Engl. 33: 2061; and in Gallop et al. (1994) J. Med. Chem. 37: 1233].
[273] Libraries of compounds are provided in solution (Houghten (1992) Biotechniques 13: 412-421), beads [Lam (1991) Nature 354: 82-84], chips [Fodor (1993) Nature 364: 555-556], bacteria [Ladner USP 5,223,409], spores [Ladner USP '409], plasmids [Cull et al. (1992) Proc Natl Acad Sci USA 89: 1865-1869] or phage (Scott and Smith (1990) Science 249: 386-390; Devlin (1990) Science 249: 404-406; Cwirla et al. (1990) Proc. Natl. Acad. Sci. 87: 6378-6382; Felici (1991) J. Mol. Biol. 222: 301-310; Ladner supra].
[274] In one embodiment, the assay comprises contacting a cell expressing a PCIP protein or a biologically active portion thereof with the test compound to determine the ability of the test compound to modulate the binding of the PCIP activity, such as a potassium channel or portion thereof, to the cell. -Based assay. Determining the ability of a test compound to modulate PCIP activity is achieved by monitoring the release of neurotransmitters such as dopamine, for example, from cells expressing PCIP, such as neuronal cells, such as melanocyte neurons, or heart cells. Can be performed. In addition, determining the ability of a test compound to modulate PCIP activity may be performed by monitoring the I _to current or release of neurotransmitters from cells expressing PCIP, such as, for example, cardiac cells. Intracellular currents, such as I _to currents, are described, for example, in Hamil et al., 1981. Pfluegers Arch. 391: 85-100, which may be measured using a patch-clamp technique as described in the Examples section using the technique described herein. For example, the cells can originate from a mammal. Determining the ability of a test compound to modulate the ability of PCIP to bind to a substrate is such that, for example, the binding of the PCIP substrate to PCIP is determined by detecting the labeled PCIP substrate in the complex, such as radioisotope or enzyme labels and PCIP. By coupling of the substrate. For example, a compound (eg, a PCIP substrate) can be labeled directly or indirectly with ¹²⁵ I, ³⁵ S, ¹⁴ C or ³ H, and the radioisotope can be detected by direct counting or scintillation counting of radioactive release. Can be. In addition, the compounds can be enzymatically labeled using, for example, horseradish peroxidase, alkaline phosphatase or luciferase, and such enzymatic labels can be detected by determining the conversion of a suitable substrate to the product. .
[275] The invention also includes determining the ability of a compound (eg, a PCIP substrate) to interact with PCIP without labeling any interactions. For example, a microphysiometer can be used to detect the interaction of a compound with PCIP without labeling the compound or PCIP. McConnell, HM et al. (1992) Science 257: 1906-1912 ]. As used herein, a "micropigometer" (eg, Cytosensor) is an analytical device that measures the rate at which cells acidify their environment using a photo-addressable potentiometric sensor (LAPS). to be. This change in acidification rate can be used as an indicator of the interaction between the compound and PCIP.
[276] In another embodiment, the assay comprises contacting a cell expressing a PCIP target molecule (eg, a potassium channel or fragment thereof) with the test compound and the test compound that modulates (eg, stimulates or inhibits) the activity of the PCIP target molecule. Cell-based assays that include determining capacity. Determining the ability of a test compound to modulate the activity of a PCIP target molecule can be performed, for example, by determining the ability of the PCIP protein to bind to or interact with a PCIP target molecule, such as a potassium channel or fragment thereof.
[277] Determining the ability of a PCIP protein or biologically active fragment thereof to bind or interact with a PCIP target molecule can be performed by one of the methods described above for direct binding. In a preferred embodiment, determining the ability of the PCIP protein to bind to or interact with the PCIP target molecule can be performed by determining the activity of the target molecule. For example, the activity of the target molecule can detect the induction of the cellular secondary messenger of the target (ie, intracellular Ca ²⁺ , diacylglycerol, IP _3, etc.), or detect the target's catalytic / enzyme activity against an appropriate substrate. Detects the induction of a reporter gene (including a target-reactive regulatory element operably linked to a nucleic acid encoding a detectable marker such as luciferase), or target-regulated cells such as release of neurotransmitters It can be determined by detecting the sex response.
[278] In another embodiment, the assay of the present invention is a cell-free assay that determines the ability of a test compound to contact a PCIP protein or biologically active moiety thereof and bind to the PCIP protein or a biologically active moiety thereof. Preferred biologically active portions of the PCIP protein used in the assays of the present invention include fragments that participate in interactions with non-PCIP molecules such as potassium channels or fragments thereof, or fragments with high surface probability scores. The binding of the test compound to the PCIP protein can be determined directly or indirectly as described above. In a preferred embodiment, the assay is the ability of the test compound to contact the PCIP protein or a biologically active portion thereof with a known compound that binds to the PCIP to form the assay mixture, contact the assay mixture with the test compound, and interact with the PCIP protein. Wherein determining the ability of the test compound to interact with the PCIP protein includes determining the ability of the test compound to preferentially bind to the PCIP or its biologically active moiety as compared to known compounds.
[279] In another embodiment, the assay is a cell free to contact the PCIP protein or biologically active portion thereof with the test compound and determine the ability of the test compound to modulate (eg, stimulate or inhibit) the activity of the PCIP protein or biologically active portion thereof. Assay. Determining the ability of a test compound to modulate the activity of a PCIP protein can be performed, for example, by determining the ability of the PCIP protein to bind to a PCIP target molecule by one of the methods described above for determining direct binding. . Determining the ability of a PCIP protein to bind to a PCIP target molecule can be performed using techniques such as real-time biomolecular interaction analysis (BIA). Sjolander, S. and Urbaniczky, C. (1991) Anal. Chem. 63: 2338-2345 and Szabo et al. (1995) Curr. Opin. Struct. Biol. 5: 699-705. As used herein, "BIA" is a technique for studying biospecific interactions in real time (eg, BIAcore) without labeling any interactions. Changes in the optical phenomena of surface plasmon resonance (SPR) can be used as indicators of real-time reactions between biological molecules.
[280] In another embodiment, determining the ability of a test compound to modulate the activity of the PCIP protein can be performed by determining the activity of the PCIP protein to further modulate the activity of the downstream effector of the PCIP target molecule. For example, the activity of an effector molecule to a suitable target can be determined as described above or the binding of the effector to a suitable target can be determined as described above.
[281] In another embodiment, the cell-free assay comprises contacting a PCIP protein or a biologically active portion thereof with a known compound that binds to the PCIP protein to form an assay mixture, contacting the assay mixture with a test compound, and interacting with the PCIP protein. Determining the ability of the test compound to determine the ability of the test compound to interact with the PCIP protein, including determining the ability of the PCIP protein to preferentially bind to or modulate its activity.
[282] Cell-free assays of the invention can use both soluble and / or membrane-bound forms of an isolated protein. For cell-free assays in which membrane-bound forms of isolated proteins are used (eg, potassium channels), it may be desirable to use solubilizers so that the membrane-bound forms of isolated proteins are maintained in solution. Examples of such solubilizers include n-octylglucoside, n-dodecylglucoside, n-dodecylmaltoside, octanoyl-N-methylglucamide, decanoyl-N-methylglucamide, Triton ^® X- 100, Triton ^® X-114, Thesit ^® , isotridecipoly (ethylene glycol ether) _n , 3-[(3-colamidopropyl) dimethylamminio] -1-propane sulfonate (CHAPS), 3- [ (3-colamidopropyl) dimethylamminio] -2-hydroxy-1-propane sulfonate (CHAPSO), or N-dodecyl = N, N-dimethyl-3-ammonio-1-propane sulfonate Such non-ionic surfactants are included.
[283] In one or more embodiments of the assay of the present invention, PCIP or a target molecule thereof to facilitate automation of the assay as well as to facilitate separation of the complexed form from the uncomplexed form of one or both proteins. It is preferable to fix the. The binding of the test compound to the PCIP protein, or the interaction of the target molecule with the PCIP protein in the presence and absence of the candidate compound, can be carried out in any container suitable for containing the reactants. Examples of such containers include microtiter plates, test tubes and micro-centrifuge tubes. In one embodiment, the fusion protein may be provided by adding a domain that allows one or both of the proteins to bind to the matrix. For example, glutathione-S-transferase / PCIP fusion protein or glutathione-S-transferase / target fusion protein can be prepared on glutathione cellose beads (Sigma Chemical, St. Louis, MO) or glutathione derivatized microtiter plates. Can be adsorbed to and then combined with the test compound or test compound and non-adsorbed target protein or PCIP protein, the mixture being under conditions conducive to complex formation (eg, physiological conditions for salts and pH). Incubated. After incubation, the beads or microtiter plate wells were washed to remove unbound components, the matrix fixed in the case of beads, and the complexes determined directly or indirectly, for example as described above.
[284] Other techniques for proteins immobilized on a matrix can also be used in the screening assays of the present invention. For example, the PCIP protein or PCIP target molecule can be immobilized using the conjugation of biotin and streptavidin. Biotinylated PCIP proteins or target molecules are prepared from biotin-NHS (N-hydroxy-succinimide) using techniques known in the art (eg, Biotinylation Kit (Pierce Chemicals, Rockford, IL)) And can be immobilized to wells of streptavidin-coated 96 well plates (Pierce Chemical). In addition, antibodies that are reactive with a PCIP protein or target molecule but do not interfere with the binding of the PCIP protein to the target molecule can be derivatized in the wells of the plate and the unbound target or PCIP protein can be derivatized in the well by antibody conjugation. Trapping. In addition to the methods described above for GST-fixed complexes, methods of detecting such complexes include the enzymatic activity associated with PCIP proteins or target molecules as well as immunodetection of complexes using antibodies reactive with PCIP proteins or target molecules. Enzyme-binding assays that depend on detecting are included.
[285] In a preferred embodiment, the candidate compound, test compound or agent is described, for example, in Komada M. et al. (1999) Genes Dev. 13 (11): 1475-85, and Roth M.G. et al. (1999) Chem. Phys. Lipids. 98 (1-2): 141-52 (PCIP molecules that modulate vesicle traffic and protein transport in cells such as neurons or heart cells using the assays described herein), the contents of which are incorporated herein by reference. It is tested for their ability to inhibit or stimulate their ability.
[286] In another preferred embodiment, candidate compounds, test compounds or agents are those that inhibit or stimulate the ability of the PCIP molecule to modulate the phosphorylation status of potassium channel proteins or portions thereof, for example using in vitro kinase assays. Tested for ability In summary, PCIP target molecules, such as immunoprecipitated potassium channels, from cell lines expressing PCIP target molecules are radioactive to the PCIP protein and radioactive in buffers containing MgCl ₂ and MnCl ₂ , such as 10 mM MgCl ₂ and 5 mM MnCl ₂ . Incubated with ATP, such as [γ- ³² P] ATP. After incubation, immunoprecipitated PCIP target molecules such as potassium channels can be separated by SDS-polyacrylamide gel electrophoresis under reducing conditions, transferred to membranes such as PVDF membranes and autoradiography performed. The appearance of a detectable band on autoradiographs indicates that the PCIP substrate, such as potassium channel, has been phosphorylated. Phosphoamino acid analysis of the phosphorylated substrate can also be performed to determine whether residues on the PCIP substrate are phosphorylated. In summary, radiophosphorylated protein bands can be excised from SDS gels and partially acid hydrolyzed. The product can then be separated by one-dimensional electrophoresis and analyzed, for example, on a phosphoimizer and compared to a ninhydrin-stained phosphoamino acid standard. For example, Tamaskovic R. et al. (1991) Biol. Chem. 380 (5): 569-78 can also be used.
[287] In another preferred embodiment, the candidate compound, test compound or agent is described, for example, in Liu L. (1999) Cell Signal. 11 (5): 317-24 and Kawai T. et al. (1999) Oncogene 18 (23): 3471-80, using their assays to inhibit or stimulate the ability of PCIP molecules to bind calcium.
[288] In another preferred embodiment, the candidate compound, test compound or agent is described, for example, in Okuwaki M. et al. (1998) J. Biol. Chem. 273 (51): 34511-8 and Miyaji-Yamaguchi M. (1999) J. Mol. Biol. 290 (2): 547-557, using their assay to test for their ability to inhibit or stimulate the ability of PCIP molecules to regulate intracellular chromatin formation.
[289] In another preferred embodiment, the candidate compound, test compound or agent is described, for example, in Baker F.L. et al. (1995) Cell Prolif. 28 (1): 1-15, Cheviron N. et al. (1996) Cell Prolif. 29 (8): 437-46, Hu Z.W. et al. (1999) J. Pharmacol. Exp. Ther. 290 (1): 28-37 and Elliott K. et al. (1999) Oncogene 18 (24): 3564-73, using the assay described in their ability to inhibit or stimulate the ability of PCIP molecules to regulate cellular proliferation.
[290] In a preferred embodiment, the candidate compound, test compound or agent is described, for example, in Gonzalez C. et al. (1998) Cell Mol. Biol. 44 (7): 1117-27 and Chia C.P. et al. (1998) Exp. Cell Res. 244 (1): 340-8, to test their ability to inhibit or stimulate the ability of PCIP molecules to regulate the binding of the cellular channel to the potassium channel protein or portions thereof.
[291] In another preferred embodiment, the candidate compound, test compound or agent is described, for example, in Bar-Sagi D. et al. (1985) J. Biol. Chem. 260 (8): 4740-4 and Barker J.L. et al. (1984) Neurosci. Lett. 47 (3): 313-8, using the assays described herein, for their ability to inhibit or stimulate the ability of PCIP molecules to modulate membrane sensitivity.
[292] In another preferred embodiment, the candidate compound, test compound or agent is described in Nakashima Y. et al. (1999) J. Bone Joint Surg. Am. 81 (5): 603-15] is tested for their ability to inhibit or stimulate the ability of PCIP molecules to modulate cytokine signaling in cells, such as neurons or cardiac cells.
[293] In another embodiment, modulators of PCIP expression are identified by a method of contacting a cell with a candidate compound and determining the expression of PCIP mRNA or protein in the cell. The expression level of PCIP mRNA or protein in the presence of the candidate compound is compared to the expression level of PCIP mRNA or protein in the absence of the candidate compound. Candidate compounds can then be identified as regulators of PCIP expression based on this comparison. For example, if the expression of PCIP mRNA or protein is greater (statistically significantly) in the presence than in the absence of the candidate compound, the candidate compound is identified as a stimulator of PCIP mRNA or protein expression. In addition, when the expression of PCIP mRNA or protein is smaller (statistically significantly smaller) in the presence than in the absence of the candidate compound, the candidate compound is identified as an inhibitor of PCIP mRNA or protein expression. The level of PCIP mRNA or protein expression in a cell can be determined by the methods described herein for detecting PCIP mRNA or protein.
[294] In another embodiment of the invention, the PCIP protein is a 2-hybrid assay or 3 to identify other proteins that bind to or interact with PCIP (“PCIP-binding protein” or “PCIP-bp”) and are involved in PCIP activity. -Hybrid test Patent No. 5,283,317; Zervos et al. (1993) Cell 72: 223-232; Madura et al. (1993) J. Biol. Chem. 268: 12046-12054; Bartel et al. (1993) Biotechniques 14: 920-924; Iwabuchi et al. (1993) Oncogene 8: 1693-1696; and Brent WO94 / 10300, as "bait proteins" (described in more detail in the Examples section below). Such PCIP-binding proteins also appear to be involved in the transmission of signals by PCIP proteins or PCIP targets, such as, for example, downstream elements of the PCIP-mediated signaling pathway. In addition, such PCIP-binding proteins appear to be PCIP inhibitors.
[295] Two-hybrid systems are based on the modular nature of most transcription factors, consisting of DNA-binding and activation domains that can be separated. In summary, the assay uses two different DNA constructs. In one construct, the gene encoding the PCIP protein is fused with a gene encoding the DNA binding domain (eg GAL-4) of a known transcription factor. In another construct, a DNA sequence from a library of DNA sequences that encodes an unidentified protein ("prey" or "sample") is fused with a gene encoding the activation domain of a known transcription factor. If the "bait" and "prey" proteins can interact in vivo to form a PCIP-dependent complex, the DNA-binding and activation domains of the transcription factor are in proximity. This proximity allows reporter genes (eg, LacZ) to be operably linked to transcriptional regulatory sites responsive to transcription factors. Expression of the reporter gene can be detected and cell colonies containing functional transcription factors can be isolated and used to obtain cloned genes encoding proteins that interact with the PCIP protein.
[296] The present invention further relates to novel agents identified by the screening assay described above. Thus, additional use of agents identified as described herein in suitable animal models is within the scope of the present invention. For example, the efficacy of treatment with these agents using agents identified as described herein (eg, PCIP modulators, antisense PCIP nucleic acid molecules, PCIP-specific antibodies or PCIP-binding partners) in animal models, Toxicity or side effects can be determined. In addition, agents identified as described herein can be used in animal models to determine the mechanism of action of such agents. The invention also relates to the use of the novel agents identified by the screening assays described above for the treatment, such as the treatment of CNA disorders or cardiovascular disorders as described herein.
[297] B. Detection Assay
[298] Some or fragments of the cDNA sequence (and corresponding complete gene sequence) identified herein can be used in various ways as polynucleotide reagents. For example, these sequences include (i) the mapping of their respective genes onto chromosomes; And thus tracking of genetic regions associated with genetic diseases; (Ii) identification of individuals from small biological samples (tissue typing); And (iii) forensic identification of biological samples. This application is described below.
[299] 1. Chromosome Mapping
[300] Once the sequence (or portion of sequence) of a gene is isolated, such sequence can be used to map the location of the gene on the chromosome. This method is called chromosome mapping. Thus, as described above, a portion or fragment of the PCIP nucleotide sequence can be used to map the position of the PCIP gene on the chromosome. The mapping of PCIP sequences to chromosomes is an important first step in associating these sequences with genes associated with the disease.
[301] In summary, the PCIP gene can be mapped to the chromosome by making PCR primers (preferably 15-25 bp in length) from PCIP nucleotide sequences. Computer analysis of PCIP sequences can be used to predict primers that do not link one or more exons in genomic DNA, which complicates the amplification process. These primers can then be used for PCR screening of somatic hybrids containing individual human chromosomes. Only hybrids containing PCIP sequences and corresponding human genes will produce amplified fragments.
[302] Somatic hybrids are made by fusing somatic cells from different mammals (eg, human and mouse cells). As the hybrid of human and mouse cells grows and divides, human chromosomes are randomly gradually lost, but mouse chromosomes are maintained. By lacking certain enzymes, mouse cells cannot grow, but by using a medium in which human cells can grow, human chromosomes containing genes encoding the necessary enzymes can be maintained. By using various media, panels of hybrid cell lines can be established. Each cell line in the panel contains a single human chromosome or a few human chromosomes, and a complete set of mouse chromosomes, facilitating the mapping of individual genes to specific human chromosomes (see D'Eustachio P. et al. (1983) Science 220; 919-924). Somatic hybrids containing only fragments of the human chromosome can also be prepared by translocation and deletion of the human chromosome.
[303] PCR mapping of somatic hybrids is a rapid process for assigning specific sequences to specific chromosomes. Three or more sequences per day can be assigned using a single temperature circulator. By using the PCIP nucleotide sequence for the design of oligonucleotide primers, sub-batching with panels of fragments from specific chromosomes can be achieved. Similarly, another mapping method that can map PCIP sequences to chromosomes is hybridization at that location (Fan, Y et al., (1990) Proc. Natl. Acad. Sci. USA, 87: 6223 -27), prescreening with labeled flow-sorting chromosomes, and preselection by hybridization to chromosome specific cDNA libraries.
[304] Fluorescence in situ hybridization (FISH) of DNA sequences for mid-term chromosomal development can be further used to provide precise chromosomal location in one step. Chromosomal development can be accomplished using cells whose division is blocked in the middle phase by a chemical such as colcemid that interferes with mitotic spindles. The chromosome is treated with trypsin for a short time and then stained with Giemsa. A pattern of bright and dark bands develops on the chromosome so that each can be identified. The FISH method can use short DNA sequences of 500 or 600 bases. However, it is more likely that clones larger than 1,000 bases will be bound at specific chromosomal sites with signal strength sufficient for simple detection. Preferably, 1,000 bases, and even more preferably 2,000 bases, are sufficient to obtain good results at a suitable time. Such methods are disclosed in the literature (Verma et al, Human Chromosomes: A Manual of Basic Techniques (Pergamon Press, New York 1988).
[305] Reagents for chromosome mapping can be used to individually mark a single chromosome or a single site on a chromosome, or a panel of reagents can be used to mark multiple sites and / or multiple chromosomes. In fact, reagents that correspond to non-coding regions of the gene are preferred for mapping. Coding sequences can be more conservative than in the gene family, thus increasing the possibility of cross hybridization during chromosome mapping.
[306] Once the sequence is mapped to precise chromosomal locations, the physical location of the sequence on the chromosome can be related to genetic map data (such data can be found, for example, in V. McKusick, Mendelian Inheritance in Man, available on- line through Johns Hopkins University Welch Medical Library). The relationship between genes and diseases mapped to the same chromosomal region can then be identified through linkage analysis (coinheritance of physically adjacent genes) (Egeland, J. et al., (1987) Nature 325: 783-787).
[307] In addition, differences in DNA sequences between individuals infected with diseases associated with the PCIP gene and those not infected can be measured. If mutations are observed in some or all of the infected individuals but not in uninfected individuals, the mutations will be pathogens of certain diseases. Comparison of infected and uninfected individuals generally involves finding deletions or translocations of genes that can be primarily observed through structural variations of the chromosome, such as chromosomal development or by PCR based on DNA sequences. do. Ultimately, the completion of gene sequences from several individuals can be performed to confirm the presence of the mutation from the polymorphism and to distinguish the mutation.
[308] 2. Tissue Typing
[309] The PCIP sequences of the present invention can also be used to identify an individual from a small amount of a biological sample. For example, the US military is considering using restriction fragment polymorphism (RELP) for human identification. In this method, the genomic DNA of an individual is digested with one or more restriction enzymes and probed in a Southern blot to create a unique band for identification. This approach removes the limitations of "dog tags" that can be lost, switched or stolen, making it difficult to identify positives. The sequences of the invention are useful as additional DNA markers for RFLP (see US Pat. No. 5,272,057).
[310] In addition, the sequences of the invention can be used to provide alternative methods for determining the actual base to base sequence of selected portions of the individual genome. As such, the PCIP nucleotide sequences described herein can be used to prepare two PCR primers from the 5 'and 3' ends of the sequence. These primers can then be used to amplify the individual DNA and subsequently sequence.
[311] A panel of corresponding DNA sequences from an individual, prepared in this manner, can provide unique individual identification as each individual has a unique set of DNA sequences due to the opposing differences. The sequences of the present invention can be used to obtain such identifying sequences from individuals and tissues. The PCIP nucleotide sequences of the present invention may uniquely represent portions of the human genome. Allelic changes occur somewhat in the coding region of these sequences and more often in the non-coding region. It is estimated that changes in alleles between individual humans occur about once every 500 bases. Each sequence described herein can be used as a standard against which DNA from an individual can be compared for purposes of identification. Since a greater number of polymorphisms occur in the non-coding regions, fewer sequences are needed to distinguish individuals. The noncoding sequence is a panel of about 10 to 1,000 primers each yielding a 100 base noncoding amplification sequence, which can provide satisfactory positive individual identification. If the predicted coding sequence is used, the number of primers more suitable for identifying positive individuals will be 500-2000.
[312] If a panel of reagents from the PCIP nucleotide sequences described herein is used to generate a unique identification database for an individual, the same reagent may then be used to identify tissue from the individual. Using a unique identification database, positive identification, survival or death of an individual can be performed from small amounts of tissue samples.
[313] 3. Use of Partial PCIP Sequences in Forensic Biology
[314] DNA-based identification methods may also be used in the forensic biology field. Forensic biology is a field of science that uses the genetic typing of biological evidence found at the crime scene, for example, as a means for the positive identification of criminal suspects. For this identification, PCR methods can be used to amplify DNA sequences taken from very small amounts of biological samples found at the crime scene, such as tissues such as hair or skin, or body fluids such as saliva, blood, or semen. Can be. The amplified sequence is then compared to a standard, whereby the origin of the biological sample can be identified.
[315] The sequences of the present invention can be used to provide polynucleotide reagents targeted to specific locations in the human genome, eg, PCR primers, which can be used, for example, in other "identifying markers" (ie, another DNA unique to a particular individual). Sequences) can increase the reliability of forensic identification based on DNA. As noted above, the actual sequencing information can be used for identification as an exact alternative to the pattern formed by fragments generated by restriction enzymes. Sequences targeted to non-coding regions are particularly suitable for this use since a greater number of polymorphisms occur in non-coding regions, which makes it easier to identify individuals in this way. Examples of polynucleotide reagents include those having a length of at least 20 bases, preferably at least 30 bases, as a PCIP nucleotide sequence or part thereof.
[316] The PCIP nucleotides described herein can also be used to identify specific tissues, such as brain tissue, for example, to provide polynucleotide reagents that are labeled or labeled probes that can be used in in situ hybridization techniques. . This may be useful when forensic pathologists provide tissues of unknown origin. Panels of such PCIP probes can be used to identify tissue by species and / or organ type.
[317] In a similar form, these reagents, such as PCIP primers or probes, can be used to screen tissue culture for contaminants (screening for the presence of different types of cell mixtures in the culture).
[318] C. Predictive Medicine:
[319] The present invention also relates to the field of predictive medicine in which diagnostic assays, prognostic assays and clinical trial monitoring are used for diagnostic (predictive) purposes to prophylactically treat an individual. Accordingly, aspects of the present invention determine whether an individual suffers from a disease or disorder by measuring PCIP activity as well as PCIP protein and / or nucleic acid expression based on a biological sample (eg, blood, serum, cells, tissue). Or to a diagnostic assay for determining if there is a risk of developing a disease associated with abnormal PCIP expression or activity. The invention also provides a diagnostic (or predictive) assay for determining whether an individual is at risk of developing a disease associated with PCIP protein, nucleic acid expression or activity. For example, variations in the PCIP gene can be assayed in biological samples. Such assays can be used for diagnostic or prophylactic purposes to prophylactically treat an individual prior to the onset of a disease characterized by or associated with PCIP protein, nucleic acid expression or activity.
[320] Another aspect of the invention relates to monitoring the effect of an agent (eg, drug, compound) on the expression or activity of PCIP in clinical trials.
[321] These and other agents will be described in more detail below.
[322] 1. Diagnostic test
[323] Exemplary methods for assaying for the presence or absence of a PCIP protein or nucleic acid in a biological sample include obtaining a biological sample from a test subject and nucleic acid (eg, mRNA, encoding the PCIP protein or PCIP protein). Contacting a compound or agent capable of detecting genomic DNA) to detect the presence of a PCIP protein or nucleic acid in a biological sample. Preferred agents for detecting PCIP mRNA or genomic DNA are labeled nucleic acid probes capable of hybridizing PCIP mRNA or genomic DNA. Nucleic acid probes include, for example, full-length PCIP nucleic acids, such as SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 5, SEQ ID NO: 7, SEQ ID NO: 9, SEQ ID NO: 11 , SEQ ID NO: 13, SEQ ID NO: 15, SEQ ID NO: 17, SEQ ID NO: 19, SEQ ID NO: 21, SEQ ID NO: 23, SEQ ID NO: 25, SEQ ID NO: 27, SEQ ID NO: 29, SEQ ID NO: 31, SEQ ID NO: 33, SEQ ID NO: 35, SEQ ID NO: 37, SEQ ID NO: 39, SEQ ID NO: 46, SEQ ID NO: 47, SEQ ID NO : 48, SEQ ID NO: 50, SEQ ID NO: 52, SEQ ID NO: 54, SEQ ID NO: 56, SEQ ID NO: 58, SEQ ID NO: 69, SEQ ID NO: 71, SEQ ID NO: 74 , SEQ ID NO: 75, SEQ ID NO: 77, SEQ ID NO: 79, SEQ ID NO: 80, SEQ ID NO: 82, SEQ ID NO: 84, SEQ ID NO: 86, SEQ ID NO: 88, SEQ Nucleic acid of ID NO: 90, SEQ ID NO: 92, SEQ ID NO: 94, SEQ ID NO: 96, SEQ ID NO: 98, SEQ ID NO: 100 or SEQ ID NO: 1002, or Accession No. 98936, 98937, 98938, 98939, 98940, 98941, 98942, 98943, 98944, 98945, 98946, 98947, 98948, 98949 No. DNA insertion plasmids deposited in the ATCC as 98950, 98951, 98991, 98993 or 98994, or portions thereof, such as at least 15, 30, 50, 100, 250 or 500 nucleotides in length. Oligonucleotides, which are sufficient to specifically hybridize under stringent conditions with PCIP mRNA or genomic DNA. Other suitable probes for use in the diagnostic assays of the present invention are described herein.
[324] Preferred agents for detecting PCIP proteins are antibodies capable of binding to PCIP proteins, preferably antibodies with detectable labels. The antibody may be polyclonal, or more preferably monoclonal. Intact antibodies, or fragments thereof (eg, Fab or F (ab ') ₂ ) can be used. The term “labeled” in the context of a probe or antibody refers to a probe or antibody by its reactivity with another directly labeled reagent as well as a direct label that couples (ie, physically binds) a detectable substance to the probe or antibody. It is intended to include indirect labels. Examples of indirect labels include detecting the first antibody using a fluorescently labeled second antibody and end labeling the DNA probe with biotin to be detected with the fluorescently labeled streptavidin. The term “biological sample” is intended to include tissues, cells, and fluids present in a subject, as well as tissues, cells, and biological fluids isolated from a subject. That is, the detection method of the present invention can be used to detect PCIP mRNA, protein, or genomic DNA in biological samples in vitro as well as in vivo. For example, in vitro techniques for detection of PCIP mRNA include Northern hybridization and in situ hybridization. In vitro techniques for the detection of PCIP proteins include enzyme immunoassay (ELISA), Western blot, immunoprecipitation and immunofluorescence. In vitro techniques for detection of PCIP genomic DNA include Southern hybridization. In addition, in vivo techniques for detection of PCIP proteins include introducing labeled anti-PCIP antibodies into a subject. For example, such antibodies can be labeled with radioactive markers whose presence and location in the subject can be detected by standard imaging techniques.
[325] In one embodiment, the biological sample comprises protein molecules from the test subject. Alternatively, the biological sample may comprise mRNA molecules from the test subject or genomic DNA molecules from the test subject. Preferred biological samples are serum samples or cerebrospinal fluid isolated from the subject by conventional means.
[326] In another embodiment, the method comprises obtaining a control biological sample from a control subject, contacting the control sample with a compound or agent capable of detecting a PCIP protein, mRNA, or genomic DNA, thereby obtaining a PCIP protein, mRNA or genomic DNA Detecting the presence of PC in the biological sample and comparing the presence of PCIP protein, mRNA or genomic DNA in the control sample to the presence of PCIP protein, mRNA or genomic DNA in the test sample.
[327] The invention also includes a kit for detecting the presence of PCIP in a biological sample. For example, the kit may comprise a labeled compound or agent capable of detecting PCIP protein or mRNA in a biological sample; Means for measuring the amount of PCIP in the sample; And means for comparing the amount of PCIP in the sample with a standard. The compound or agent may be packaged in a suitable container. The kit may further comprise instructions for using the kit to detect a PCIP protein or nucleic acid.
[328] 2. Prognosis test
[329] The diagnostic methods described herein can also be used to identify subjects who have or are at risk of having a disease or condition associated with aberrant PCIP expression or activity. For example, assays described herein, such as prior diagnostic assays or subsequent assays, may be used for neurodegenerative diseases such as Alzheimer's disease, Alzheimer's disease, dementia (such as Peak disease), Parkinson's disease and other Lewy diffuse bodies. body) diseases, multiple sclerosis, amyotrophic lateral sclerosis, progressive upper nucleus palsy, epilepsy, spinal cerebellar ataxia and Creutzfeldt-Jakob disease; Mental disorders such as depression, schizophrenia, Korsakoff psychosis, mania, anxiety, bipolar disorder or phobia; Learning or memory disorders, such as memory loss or memory loss associated with aging; Neurological diseases such as migraine; Pain disorders such as hyperalgesia or pain associated with musculoskeletal disorders; Spinal cord injury; heart attack; And head trauma; Or PCIP protein activity such as cardiovascular diseases, such as cryo node failure, angina pectoris, heart attack, hypertension, cardiac fibrillation, atrial flutter, dilatation cardiomyopathy, idiopathic cardiomyopathy, myocardial infarction, coronary artery disease, coronary artery spasm or arrhythmia Or to identify subjects who are at risk of developing disease associated with misregulation in nucleic acid expression.
[330] Alternatively, prognostic assays can be used to identify subjects who have or are at risk for developing diseases associated with regulatory errors in nucleic acid expression or PCIP protein activity, such as potassium channel related diseases. Accordingly, the present invention obtains a test sample from a subject and detects a PCIP protein or nucleic acid (eg, mRNA or genomic DNA) such that the presence or absence of a PCIP protein or nucleic acid is associated with abnormal PCIP expression or activity, or A method of identifying a disease or condition associated with abnormal PCIP expression or activity is provided for diagnosing a subject at risk. As used herein, “test sample” means a biological sample obtained from a subject. For example, the test sample can be a biological fluid (eg, serum), cell sample, or tissue.
[331] In addition, the prognostic assays described herein can be carried out on an agent (eg, agonist, antagonist, peptidomimetic, protein, peptide, nucleic acid, small molecule) to treat a disease or condition associated with abnormal PCIP expression or activity. , Or other drug candidates). For example, such methods can be used to determine whether a subject can be effectively treated with agents for CNS disease or cardiovascular disease. Accordingly, the present invention is directed to obtaining a test sample and detecting PCIP protein or nucleic acid expression or activity (e.g., to treat a disease in which a large amount of PCIP protein or nucleic acid expression or activity is associated with abnormal PCIP expression or activity). By diagnosing the subject to which I can be administered) to determine whether the subject can be effectively treated with an agent for a disease associated with abnormal PCIP expression or activity.
[332] The method of the present invention also detects genetic alterations in the PCIP gene such that a subject with the modified gene is at risk of developing a disease characterized by regulatory errors in nucleic acid expression or PCIP protein activity such as CNS disease or cardiovascular disease. Can be used to measure In a preferred embodiment, the methods of the present invention detect the presence of a genetic modification in a cell sample from a subject, characterized by one or more modifications that affect the integrity of the gene encoding the PCIP-protein or the misexpression of the PCIP gene. It involves doing. For example, such genetic modifications may include 1) deletion of one or more nucleotides from the PCIP gene; 2) addition of one or more nucleotides to the PCIP gene; 3) substitution of one or more nucleotides of the PCIP gene; 4) chromosome rearrangement of the PCIP gene; 5) modification of the mRNA electron level of the PCIP gene; 6) aberrant modification of the PCIP gene, such as the methylation pattern of genomic DNA, 7) the presence of non-wild-type slicing patterns of mRNA transcription of the PCIP gene, 8) non-wild-type levels of PCIP-protein, 9) allele loss of the PCIP gene, and 10) can be detected by identifying the presence of one or more of the incompatible posttranslational modifications of the PCIP protein. As described herein, there are many such known assay methods that can be used to detect modifications in the PCIP gene. Preferred biological samples are tissue or serum samples isolated by conventional means from the subject.
[333] In certain embodiments, the detection of the modification may be a polymerase chain reaction (PCR) such as anchor PCR or RACE PCR (see, eg, US Pat. Nos. 4,683,195 and 4,683,202), or alternatively a ligation chain reaction (LCR) ( See, eg, Landegran et al. (1988) Science 241: 1077-1080; and Nakazawa et al. (1994) Proc. Natl. Acad. Sci. USA 91: 360-364) . May be particularly useful for detecting point mutations in the PCIP gene. Abravaya et al. (1995) Nucleic Acids Res. 23: 675-682. The method comprises the steps of: collecting a cell sample from a subject, isolating nucleic acid (eg, genome, mRNA, or both) from the sample cell, contacting the nucleic acid sample with one or more primers, if present ) Hybridization, and specifically hybridizing to the PCIP gene under conditions where amplification occurs and detecting the presence or absence of the amplification product, detecting the size of the amplification product, and comparing the length to the control sample. It may include a step. It is contemplated that PCR and / or LCR would be preferred to use as a preamplification step in conjunction with the techniques used to detect the mutations described herein.
[334] Another amplification method is self-contained sequence replication (Guatelli, JC et al., (1990) Proc. Natl. Acad. Sci. USA 87: 1874-1878), transcription amplification system (Kwoh, DY et al., (1989) Proc Natl.Acad.Sci . USA 86: 1173-1177), Q-beta replicase (Lizardi, PM et al. (1988) Bio-Technology 6: 1197), or other methods of nucleic acid amplification, and then Amplified molecules are detected using techniques well known to those skilled in the art. Such a detection method is particularly useful for detecting nucleic acid molecules when there are very few such molecules.
[335] In another embodiment, variations in the PCIP gene from sample cells can be identified by modifications in restriction enzyme degradation patterns. For example, samples and control DNA are isolated, amplified (optionally), digested with one or more restriction endonucleases, and fragment length sizes are measured and compared by gel electrophoresis. The difference in fragment length size between the sample and the control DNA indicates a variation in the sample DNA. In addition, the use of sequence specific ribozymes (see, eg, US Pat. No. 5,498,531) can be used to record the presence of specific mutations due to the development or loss of ribozyme degradation sites.
[336] In another embodiment, genetic variations in PCIP can be identified by hybridizing a sample and a control nucleic acid, eg, DNA or RNA, to a high density array containing hundreds or thousands of oligonucleotide probes. Cronin, MT et al., (1996) Human Mutation 7: 244-255; Kozal, MJ et al. (1996) Nature Medicine 2: 753-759. For example, genetic variation in PCIP may be described in the above Cronin, M. a. tea. It can be identified in a two-dimensional array containing photo-generated DNA probes as described in, et al. In summary, a first hybridization array of probes can be used to scan long stretches of DNA in samples and controls to create a linear array of sequential overlapping probes to identify base changes between sequences. This step allows the identification of point mutations. This step is followed by a second hybridization arrangement that allows for the characterization of specific variations by using smaller, specialized probes that are complementary to all variants or variants detected. Each variant array consists of parallel probe sets, one complementary to the wild type gene and the other complementary to the variant gene.
[337] In another embodiment, several known sequencing reactions can be used to detect variations by directly sequencing the PCIP gene and comparing the sequence of the sample PCIP to the corresponding wild type (control) sequence. Examples of sequencing reactions include Maxim and Gilbert ((1997) Proc. Natl. Acad. Sci. USA 74: 560) or Sanger ((1997) Proc. Natl. Acad. Sci. USA 74: 5463) and those based on the techniques developed by them. In addition, several automated sequencing procedures can be performed by mass spectrometry (see, eg, PCT International Application WO 94/16101; Cohen et al. (1996) Adv. Chromatogr. 36: 127-162; and Griffin et al. (1993) Appl. It is contemplated that it may be used when performing diagnostic assays ((1995) Biotechniques 19: 448), including sequencing by Biotechnol . 38: 147-159.
[338] Another method for detecting mutations in the PCIP gene is that protection from degradation agents is used to detect mismatch bases in RNA / RNA or RNA / DNA heteroduplexes. Myers et al. (1985) Science 230: 1242. In general, this technique of “mismatch degradation” is disclosed by providing a heteroduplex formed by hybridizing (labeled) RNA or DNA containing wild-type PCIP sequences to potential mutant RNA or DNA obtained from a tissue sample. Double stranded duplexes are treated with agents that break down the single stranded region of the duplex due to base pair mismatch between the control and sample strands. For example, RNA / DNA duplexes can be treated with RNase and DNA / DNA hybrids treated with S1 nuclease that enzymatically degrades mismatched regions. In other embodiments, the DNA / DNA or RNA / DNA duplexes can be treated with hydroxylamine or osmium tetraoxide, and with piperidine to degrade the non-matching region. After degradation of the non-matching region, the material formed is then degraded to size for polyacrylamide gel denaturation to determine the site of variation (see Cotton et al. (1988) Proc. Natl Acad Sci USA 85: 4397; Saleeba et al. (1992) Methods Enzymol . 217: 286-295. In a preferred embodiment, the control DNA or RNA can be labeled for detection.
[339] In another embodiment, the nonmatching degradation reaction is directed at double stranded DNA (so-called "DNA mismatch repair" enzyme) in a system defined for detecting and mapping point mutations in PCIP cDNA obtained from a sample of cells. One or more proteins that recognize match base pairs are used. For example, E. coli's mutY enzyme degrades A in G / A nonmatches and thymidine DNA glycosylase from HeLa cells degrades T in G / T mismatches. See Hsu et al. (1994) Carcinogenesis 15: 1657-1662. According to an exemplary embodiment, a probe based on a PCIP sequence, eg, a wild type PCIP sequence, is hybridized with cDNA or other DNA product from test cells. This duplex can be treated with DNA mismatch repair enzymes so that degradation products can be detected from electrophoresis protocols and the like, if present (see, eg, US Pat. No. 5,459,039).
[340] In another embodiment, alterations in electrophoretic mobility can be used to identify variations in the PCIP gene. For example, single strand conformation polymorphism (SSCP) can be used to detect differences in electrophoretic mobility between variants and wild-type nucleic acids. See Orita et al. (1989) Proc Natl. Acad. Sci USA: 86: 2766; Cotton (1993) Mutat. Res . 285: 125-144; and Hayashi (1992) Genet. Anal. Tech. Appl. 9: 73-79. Single stranded DNA fragments of the sample and control PCIP nucleic acid will be denatured and denatured. The second structure of the single stranded nucleic acid varies from sequence to sequence, such that modifications in electrophoretic mobility allow detection of even single base changes. DNA fragments can be labeled or detected with labeled probes. The sensitivity of the assay can be enhanced by using RNA (rather than DNA), where the second structure is more sensitive to sequence changes. In a preferred embodiment, the method uses heteroduplex analysis to separate double stranded heteroduplex molecules based on changes in electrophoretic mobility (Keen et al. (1991) Trends Genet 7: 5).
[341] In another embodiment, transfer of variant or wild-type fragments in polyacrylamide gels containing a gradient of denaturation is assayed using denaturing gradient gel electrophoresis (DGGE). Myers et al. (1985) Nature 313: 495]. If DGGE is used as the assay, the DNA will be modified to ensure that it is not completely denatured, for example, by adding a GC clamp of about 40 bp of high-melting GC-rich DNA by PCR. In another embodiment, temperature gradients are used in place of denaturation gradients to identify differences in mobility between control and sample DNA (Rosenbaum and Reissner (1987) Biophys Chem 265: 12753).
[342] Examples of other techniques for detecting point mutations include, but are not limited to, selective oligonucleotide hybridization, selective amplification, or selective primer extension. For example, oligonucleotide primers can be prepared by centering known variations and then hybridizing to the target DNA under conditions that permit hybridization only if a complete match is found. See Saiki et al. 1986) Nature 324: 163; Saiki et al. (1989) Proc. Natl Acad. Sci USA 86: 6230. Such allele specific oligonucleotides hybridize to PCR amplified target DNA or a number of different variants when the oligonucleotide is attached to the hybridization membrane and hybridizes with the labeled target DNA.
[343] Alternatively, allele specific amplification techniques that rely on selective PCR amplification can be used with the present invention. Oligonucleotides used as primers for specific amplification may be mismatched at the center of the molecule (so that the amplification depends on differential hybridization) (Gibbs et al. (1989) Nucleic Acids Res. 17: 2437-2448) or under suitable conditions . It may have a mutant of interest at the extreme 3 'end of the primer (Prossner (1993) Tibtech 11: 238) that can prevent or reduce polymerase extension. It may also be desirable to introduce new restriction sites into the mutation region to create detection based on degradation. Gasparini et al. (1992) Mol. Cell Probes 6: 1]. In certain embodiments, it is expected that amplification can be performed using Taq ligase for amplification . Barany (1991) Proc. Natl. Acad. Sci USA 88: 189]. In this case, a linkage will only occur if there is a perfect match at the 3 'end of the 5' sequence to find the presence or absence of amplification, thereby making it possible to detect the presence of a known mutation at a specific site.
[344] The methods described herein comprise, for example, one or more probe nucleic acid or antibody reagents described herein that can be conveniently used in a clinical setting for diagnosing a patient exhibiting symptoms or family history of a disease or illness involving the PCIP gene. This can be done by using a diagnostic kit packaged before sale.
[345] Moreover, cell types or tissues in which PCIP is expressed can be used in the diagnostic assays described herein.
[346] 3. Monitoring of effects during pregnancy experiments
[347] Monitoring the effect of an agent (eg, a drug) on the expression or activity of a PCIP protein (eg, regulation of membrane excitability or resting potential) can be applied in clinical trials as well as in basic drug screening. . For example, the efficacy of an agent determined by a screening assay as described herein for increasing PCIP gene expression, protein levels, or up-regulating PCIP activity may result in decreased PCIP gene expression, protein levels or down-regulated PCIP activity. Can be monitored in clinical trials of subjects showing Alternatively, clinical trials of subjects with increased PCIP gene expression, protein levels, or up-regulated PCIP activity, as measured by screening assays for reducing PCIP gene expression, protein levels, or down-regulating PCIP activity. Can be monitored in the test. In such clinical trials, the expression or activity of the PCIP gene and preferably other genes related to, for example, potassium channel related diseases, can be used as phenotypic markers or "read out" of particular cells.
[348] For example, genes comprising PCIP, which are modulated in cells by treatment with agents that modulate PCIP activity (e.g., identified in the screening assays as described herein) (e.g., compounds, drugs or small molecules). Can be identified, but is not limited thereto. Thus, for example, to study the effects of an agent on potassium channel related diseases in clinical trials, cells can be isolated, RNA prepared, and analyzed for expression levels of PCIP and other genes related to potassium channel related diseases, respectively. have. The level of gene expression (eg, gene expression pattern) can be determined by any one of the methods described herein by Northern blot analysis or RT-PCR as described herein or by measuring the amount of protein produced. Or by measuring the activity level of PCIP or other genes. In this way, gene expression patterns can serve as markers indicative of the physiological response of the cell to the agent. Thus, this response state can be measured at various time points before and during the individual being treated with the agent.
[349] In a preferred embodiment, the invention comprises the steps of (i) obtaining a predose sample from a subject prior to administering the agent; (ii) detecting the expression level of PCIP protein, mRNA, or genomic DNA in the sample prior to administration; (iii) obtaining one or more post-administration samples from the subject; (iv) detecting the expression or activity level of PCIP protein, mRNA or genomic DNA from the sample after administration; (v) comparing the expression or activity level of the PCIP protein, mRNA or genomic DNA of the sample before administration with the PCIP protein, mRNA or genomic DNA of the sample (s) after administration; And (vi) thus altering the administration of the agent to the subject, thereby subjecting the subject to an agent (eg, an agonist, antagonist, peptidomimetic, protein, peptide, nucleic acid, small molecule, or screening assay described herein). A method of monitoring the efficacy of treatment with other drug candidates identified by) is provided. For example, increasing the administration of an agent increases the expression or activity of PCIP above the level detected, ie, increases the efficacy of the agent. Alternatively, reducing the administration of an agent is preferred to reduce the expression or activity of PCIP below the level detected, ie to reduce the efficacy of the agent. According to this embodiment, PCIP expression or activity can be used as a cognitive agent for the efficacy of an agent in the absence of an observable phenotypic response.
[350] D. Treatment Methods
[351] The present invention provides prophylactic and therapeutic methods for treating subjects who are at risk of developing (or are prone to) disease associated with aberrant PCIP expression or activity. With regard to prophylactic and therapeutic methods of treatment, such treatments can be specifically tailored or modified based on knowledge obtained from the field of “pharmacogenomics”. As used herein, "pharmacological genetics" refers to the application of genomic techniques such as gene sequencing, statistical genetics and clinical development and gene expression analysis for drugs in the market. More specifically, the term is to study how the gene of a patient determines the response to the drug (eg, the "drug response phenotype" or "drug response factor" of the patient). Accordingly, another aspect of the present invention provides a method of tailoring the prophylactic or therapeutic treatment of an individual with the PCIP molecule or PCIP modulator of the present invention according to the drug response factor type of such individual. Pharmacogenetics can enable a clinician or physician to prophylactically or therapeutically treat a patient who will be very advantageous from treatment, and prevent the patient from having a toxic drug related side effect.
[352] 1. How to prevent
[353] In one aspect, the invention provides a method of inhibiting from a subject a condition or disease associated with aberrant PCIP expression or activity by administering to the subject an agent or agent that modulates PCIP expression or one or more PCIP activities. Subjects at risk of developing a disease caused by or contributing to aberrant PCIP expression or activity can be identified, for example, by any of the diagnostic or prophylactic assays described herein, or a combination thereof. Administration of the prophylactic agent may be made before the symptoms characteristic of PCIP abnormalities are manifested such that the disease or disorder is prevented or otherwise delayed progression. Depending on the type of PCIP abnormality, for example, PCIP, PCIP agonists or PCIP antagonists can be used to treat the subject. Suitable agents can be measured based on the screening assays described herein.
[354] 2. Treatment Method
[355] Another aspect of the invention relates to a method of modulating PCIP expression or activity for therapeutic purposes. Thus, in an exemplary embodiment, a method of modulating the invention comprises contacting a cell with an agent or a PCIP that modulates one or more activities of PCIP protein activity associated with the cell. Agents that modulate PCIP protein activity include nucleic acids or proteins, natural target molecules of the PCIP protein (e.g., PCIP substrates), PCIP antibodies, PCIP agonists or antagonists, peptidomimetic or other small molecules of PCIP agonists or antagonists. Such as agents described herein. In one embodiment, the agent stimulates one or more PCIP activities. Examples of such stimulatory agents include nucleic acid molecules and active PCIP proteins encoding PCIP introduced into the cell. In another embodiment, the agent inhibits one or more PCIP activities. Examples of such inhibitors include antisense PCIP nucleic acid molecules, anti-PCIP antibodies and PCIP inhibitors. Such modulating methods may be performed in vitro (eg, by culturing the cells with an agent), or alternatively, in vivo (eg, by administering the agent to a subject). As such, the present invention provides a method for treating an individual suffering from a disease or condition characterized by aberrant expression or activity of a PCIP protein or nucleic acid molecule. Examples of such diseases include CNS diseases such as neurodegenerative diseases, for example Alzheimer's disease, dementia (such as Peak disease) associated with Alzheimer's disease, Parkinson's disease and other Louis Diffuse body disease, multiple sclerosis, amyotrophic lateral sclerosis, Advanced upper nucleus palsy, epilepsy and Creutzfeldt-Jakob disease; Mental disorders such as depression, schizophrenia, Korsakoff psychosis, mania, anxiety, bipolar disorder or phobia; Learning or memory disorders, such as memory loss or memory loss associated with aging; Neurological diseases such as migraine; Pain disorders such as hyperalgesia or pain associated with musculoskeletal disorders; Spinal cord injury; heart attack; And head trauma; Or cardiovascular diseases such as atherosclerosis, ischemic reperfusion injury, restenosis, arterial inflammation, vascular wall remodeling, ventricular remodeling, rapid cardiac tuning, coronary microembolism, tachycardia, bradycardia, pressure overload, aortic flexion, coronary artery connection , Vascular heart disease, Atrial fibrosis, Intestinal QT syndrome, Congestive heart failure, Cryo node failure, Angina pectoris, Heart attack, Hypertension, Cardiac fibrillation, Atrial fibrillation, Expanded cardiomyopathy, Idiopathic cardiomyopathy, Myocardial infarction, Coronary artery disease, Coronary artery Arterial spasms or arrhythmia. In one embodiment, the invention administers an agent (eg, an agent identified by the screening assay described herein) or a combination of agents that modulates (eg, upregulates or downregulates) PCIP expression or activity. It involves doing. In another embodiment, the invention comprises administering a PCIP protein or nucleic acid molecule as a therapeutic to compensate for reduced or abnormal PCIP expression or activity.
[356] Preferred embodiments of the invention include methods of treating PCIP related diseases or disorders, including administering to a subject a therapeutically effective amount of a PCIP antibody. As defined herein, a therapeutically effective amount (ie, an effective dosage) of an antibody is from 0.001 to 30 mg, preferably from about 0.01 to 25 mg, more preferably from about 0.1 to 20 mg, even more preferably from about 1 to 10 mg, 2-9 mg, 3-8 mg, 4-7 mg, or 5-6 mg. Those skilled in the art will appreciate that certain factors, including but not limited to the severity of the disease or disorder, the general health and / or age of the subject, and other diseases present, will affect the dosage required to effectively treat the subject. It will be appreciated. In addition, treating a subject with a therapeutically effective amount of an antibody can include a single treatment, or preferably can include a combination treatment. In a preferred embodiment, the subject is once per week for about 1 to 10 weeks, preferably 2 to 8 weeks, more preferably about 3 to 7 weeks, more preferably about 4, 5 or 6 weeks, about 0.1 to Treatment with antibodies in the 20 mg / kg body weight range. In addition, it will be appreciated that the effective dosage of the antibody used for treatment may increase or decrease over the course of a particular treatment. The change in dosage may be due to the results of the diagnostic assays described herein.
[357] Stimulation of PCIP activity is desirable in situations where PCIP is abnormally downregulated and / or increased PCIP activity would have a beneficial effect. For example, stimulation of PCIP activity is desirable in situations where PCIP is downregulated and / or increased PCIP activity is likely to have a beneficial effect. Likewise, inhibition of PCIP activity is desirable in situations where PCIP activity is abnormally upregulated and / or reduced PCIP activity is likely to have a beneficial effect.
[358] 3. Pharmacological Genetics
[359] Potassium channels associated with aberrant PCIP activity are administered to an individual in addition to the PCIP molecule of the invention, as well as an agent or modulator having a facilitating or inhibitory effect on PCIP activity (eg, PCIP gene expression) identified by the screening assays described herein. Related disorders (e.g., CNS diseases such as neurodegenerative diseases, for example Alzheimer's disease, dementia (such as Peak disease) associated with Alzheimer's disease, Parkinson's disease and other Louis Diffus body disease, multiple sclerosis, Amyotrophic lateral sclerosis) , Progressive upper nucleus palsy, epilepsy, spinal cerebellar ataxia and Creutzfeldt-Jakob disease; mental disorders such as depression, schizophrenia, Korsakov psychosis, mania, anxiety, bipolar disorder or phobias; learning or memory disorders, for example Memory loss, or aging-related memory loss; neurological disorders such as migraine; pain disorders such as musculoskeletal Hyperalgesia or pain associated with babies; spinal cord injury; heart failure; and head trauma; or cardiovascular diseases such as atherosclerosis, ischemic reperfusion injury, restenosis, arterial inflammation, vascular wall remodeling, ventricular remodeling, rapid mental and physical coordination, Coronary microembolism, pulmonary rhythm, bradycardia, pressure overload, aortic flexion, coronary artery connection, vasculature heart disease, atrial fibrillation, intestinal QT syndrome, congestive heart failure, cryo node failure, angina pectoris, heart attack, hypertension, cardiac fibrillation, atrial fibrillation , Expandable cardiomyopathy, idiopathic cardiomyopathy, myocardial infarction, coronary artery disease, coronary artery spasm or arrhythmia) (prophylactically or therapeutically). In conjunction with such treatment, pharmacogenetics (study on the relationship between an individual's genotype and an individual's response to a foreign compound or drug) can be considered. Differences in the metabolism of a therapeutic agent can cause severe toxicity or treatment failure by altering the relationship between dose and blood concentration of the pharmacologically active drug. Thus, the physician or clinician may use the knowledge gained in the relevant pharmacogenetic research in adjusting the therapeutic regimen and / or dosage of treatment using the PCIP molecule or PCIP modulator, as well as in determining whether to administer the PCIP molecule or PCIP modulator. Consideration may apply.
[360] Pharmacogenetics deals with clinically important genetic modifications in response to drugs due to altered drug properties and adverse effects in diseased humans. See, for example, Eichelbaum, M. et al. (1996) Clin. Exp. Pharmacol. Physiol . 23 (10-11): 983-985 and Linder, MW et al. (1997) Clin. Chem. 43 (2): 254-266]. In general, it can be divided into two types of pharmacogenetic state. It is either a hereditary state that is inherited as a single factor that changes the way the drug acts on the human body (modified drug action) or a hereditary state that is inherited as a single factor that changes the way the human body acts on the drug (modified drug metabolism). . Such pharmacogenetic states can occur as naturally occurring polymorphisms or as rare genetic defects. For example, glucose-6-phosphate dehydrogenase deficiency (G6PD) is a major clinical complication that occurs after ingestion of oxidizing drugs (anti-malarial, sulfonamide, analgesic, nitrofuran) and consumption of favia beans. It is a common genetic enzyme disease that is later hemolysis.
[361] One of the pharmacogenomic methods for identifying genes that predict drug responses known as "genome-wide associations" is mainly for known gene related markers (e.g. humans with two variants each). And a high resolution map of the human genome consisting of "non-allele" genetic marker maps consisting of 60,000-100,000 polymorphic or variable regions on the genome. Such high resolution genetic maps can compare genomic maps of each statistically significant number of patients participating in a Phase II / III drug test to identify markers associated with specific observed drug responses or side effects. It can be generated from a combination of tens of thousands of known single nucleotide polymorphs (SNPs) of the human genome. As used herein, “SNP” is a general modification that occurs at a single nucleotide base in a DNA stretch. For example, SNPs can occur once every 1000 bases of DNA. SNPs may be involved in the disease process, but the majority may not be related to the disease. Given genetic maps based on these SNP occurrences, individuals can be grouped into genetic categories that depend on particular patterns of SNPs in the individual's genome. In this way, one can adjust to a group of genetically similar individuals, taking into account characteristics that may be common among such genetically similar individuals.
[362] Alternatively, "candidate gene method" can be used to identify genes that predict drug response. According to this method, if the gene encoding the drug target is known (e.g., the PCIP protein of the invention), all common variants of these genes can be identified fairly easily in the population, It can be determined whether having one type of gene is associated with a particular drug response.
[363] In an exemplary embodiment, the activity of drug metabolizing enzymes is a major determinant of both strength and duration of drug activity. The discovery of genetic polymorphisms of drug metabolizing enzymes has provided an explanation for why some patients do not achieve the expected efficacy after taking standard and safe doses of the drug or exhibit excessive drug reactions and severe toxicity. These polymorphisms are expressed in the population as two phenotypes, wide metabolic patients (EM) and low metabolic patients (PM). The preponderance of PM is different within various groups. For example, gene coding for CYP2D6 is highly polymorphic and several variants have been identified in PM, all of which result in a deficiency of functional CYP2D6. Low metabolic patients of CYP2D6 and CYP2C19 experience excessive drug reactions and side effects very frequently when standard doses are administered. If the metabolite is an active therapeutic moiety, the PM does not show a therapeutic response, as demonstrated for the analgesic effect of codeine mediated by CYP2D6-forming metabolite morphine. Another extreme is the so called fast metabolism, which do not respond to standard doses. Recently, a molecular basis has been identified that ultrafast metabolism is due to CYP2D6 gene amplification.
[364] Alternatively, a method called “gene expression profiling” can be used to identify genes that predict drug response. For example, gene expression in an animal administered with a drug (eg, a PCIP molecule or PCIP modulator of the invention) may provide an indication as to whether a genetic pathway associated with toxicity has been disclosed.
[365] Information generated by the one or more pharmacogenomics approaches can be used to determine appropriate dosages and treatment regimens for prophylactic or therapeutic treatment of an individual. This knowledge can, when applied to dosing or drug selection, avoid side effects or treatment failures, and thus control the patient to be identified by a PCIP molecule or a PCIP modulator, eg, one of the exemplary screening assays described herein. Zero treatment may increase the therapeutic or prophylactic efficacy.
[366] 4. Use of PCIP molecules as surrogate markers
[367] In addition, the PCIP molecules of the present invention are useful as markers of disease or disease state, as markers for prognostic of disease states, as markers for disease states, as markers of drug activity, or as markers of pharmacogenetic profiles of patients. . Using the methods described herein, the presence, absence and / or quantification of the PCIP molecules of the invention can be detected and associated with one or more biological states in the human body. For example, the PCIP molecule of the invention acts as a surrogate marker for one or more diseases or disease states, or for conditions up to and including the disease state.
[368] A “substitute marker” herein is an objective biochemical marker that is associated with the absence or presence of a disease or disorder or related to the progression of a disease or disorder (eg, associated with the presence or absence of a tumor). The presence or amount of such markers is independent of the cause of the disease. Thus, these markers indicate whether a particular course of treatment is effective in alleviating a disease state or disease. Substitute markers may be required if the disease state or presence or extent of the disease is difficult to test with standard methodologies (eg, early stage tumors), or before testing for disease progression reaches a potentially dangerous clinical endpoint. Particularly useful in cases where, for example, prior to the undesirable clinical appearance of myocardial infarction or fully advanced AIDS, assays of cardiovascular disease are well performed using cholesterol levels as surrogate markers, and analysis of HIV infection is substituted Well performed using HIV RNA levels as markers). Examples of use of surrogate markers in the prior art are described in Koomen et al., (2000) J. Mass. Spectrom. 35: 258-264; and James (1994) AIDS Treatment News Archive 209.
[369] In addition, the PCIP molecules of the present invention are useful as pharmacokinetic markers. A "pharmacokinetic marker" herein is an objective biochemical marker specifically related to drug effects. The presence or amount of pharmacokinetic markers is not related to the disease state or condition in which the drug is administered; Thus, the presence or amount of the marker implies the presence or activity of the drug in the patient. For example, pharmacokinetic markers may imply concentrations of the drug in biological tissue as the marker is expressed or transcribed, non-expressed or nontranscribed in tissue with respect to the level of the drug. In this way, the distribution or absorption of the drug can be observed by pharmacokinetic markers. Similarly, the presence or amount of pharmacokinetic markers may be related to the presence or amount of metabolic products of the drug, such that the presence or amount of the markers suggests a relative rate of disintegration of the drug in vivo. Pharmacokinetic markers are particularly useful for increasing the detection sensitivity of drug effects, especially when the drug is administered in small amounts. Although a small amount of drug may be sufficient to activate transcription or expression of several markers (eg PCIP markers), the amplified marker may be an amount that can be detected immediately than the drug itself. In addition, markers can be more easily detected due to their nature; For example, using the methods described herein, anti-PCIP antibodies can be used in an immune based detection system for PCIP protein markers, or PCIP specific radiolabeled probes can be used to detect PCIP mRNA markers. have. In addition, the use of pharmacokinetic markers provides a mechanism based prediction for risks due to drug treatment beyond the possible direct observation range. Examples of use of conventional pharmacokinetic markers are described in Matsuda et al. US 6,033,862; Hattis et al. (1991) Env. Health Perspect. 90: 229-238; Schentag (1999) Am. J. Health-Syst. Pharm. 56 Suppl. 3: S21-S24; And Nicolau (1999) Am. J. Health-Syst. Pharm. 56 Suppl. 3: S16-S20.
[370] In addition, the PCIP molecules of the present invention are useful as pharmacogenetic markers. A “pharmacogenetic marker” herein is an objective biochemical marker associated with specific clinical drug response or sensitivity in a patient. See, eg, McLeod et al. (1999) Eur. J. Cancer 35 (12): 1650-1652]. The presence or amount of pharmacogenetic marker is related to the patient's expected response to a particular drug or class of drugs prior to administering the drug. By assaying the presence or amount of one or more pharmacogenetic markers in the patient, the drug treatment can be selected that is most suitable for the patient or predicted to be more successful. For example, based on the presence or amount of RNA or protein (eg, PCIP protein or RNA) for a particular tumor marker in the patient, a treatment drug or route is selected that is optimized for the treatment of the particular tumor that may be present in the patient. Can be. Similarly, the presence or absence of specific sequence variations in PCIP DNA can be associated with PCIP drug responses. Thus, the use of pharmacogenetic markers allows one to apply the most appropriate treatment to each patient without the need to administer prescription drugs.
[371] The invention will be further illustrated by the following examples which are not intended to limit the invention. The contents, figures and sequences of all references cited herein are hereby incorporated by reference.
[372] Example
[373] The following materials and methods were used in the examples.
[374] Strain, plasmid, bait cDNA, and general microbiological techniques
[375] Basic yeast strains (HF7c, Y187) bait (pGBT9) and fish (pACT2) plasmids used in this experiment were purchased from Palo Alto, Calif. CDNAs encoding rats Kv4.3, Kv4.2, and Kv1.1 were provided by Weeth-Ayerst Research (865 Ridge Rd., Monmouth Junction, NJ 08852). Prepare standard yeast media including synthetic complete media lacking L-leucine, L-tryptophan and L-histidine, and refer to yeast genetic engineering, see Sherman (1991) Meth. Enzymol. 194: 3-21. Yeast transformation is standard protocol [Gietz et al. (1992) Nucleic Acids Res. 20: 1425; Ito et al (1983) J. Bacteriol. 153: 163-168. Plasmid DNA was isolated from yeast strains by standard methods (Hoffman and Winston (1987) Gene 57: 267-272).
[376] Bate and Yeast Strain Composition
[377] First 180 amino acids of rKv4.3 [Ref. Serdio P. et al. (1996) J. Neurophys 75: 2174-2179] was amplified by PCR and cloned into pGBT9 in a frame to obtain plasmid pFWA2 (hereafter "bait"). These baits were transformed into 2-hybrid screening strain HF7c and tested for expression and self-activation. These baits were identified for expression by Western blot. rKv4.3 bait did not self-activate in the presence of 10 mM 3-amino-1,2,3-triazole (3-AT).
[378] Library Configuration
[379] Rat midbrain tissue was provided by Wetmouth-Ayerst Research (NJ). Whole cytoplasmic RNA was described by standard techniques [Sample, J., Fritsh, E. F., and Maniatis, T. Molecular Clonin: A Laboratory Manual. 2nd, ed., Cold Spring Harbor Laboratory, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY, (1989)]. MRNA was prepared using the poly-A spin mRNA isolation kit purchased from New England Biolab (Beverly, MA). CDNA was synthesized from mRNA samples using cDNA Synthesis Kit purchased from Stratagen (La Jolla, Calif.) And ligated to pACT2 ′ EcoRI and XhoI sites to generate a 2-hybrid library.
[380] 2-hybrid screening
[381] Essentially a reference [Bartel, P. et al. 91993) "Using the Two-Hybrid Systemto Detect Polypeptide-Polypeptide Interactions" in Cellular Interactions in Development: A Practical Approach, Hartley, D.A. ed. Oxford University Press, Oxford, pp. 153-179, two-hybrid screens were performed with bait-library pairs of the rkv4.3 bait-rat midbrain library. Essentially a reference [Brill et al. (1994) Mol. Biol. Cell. 5: 297-312, a filter disk beta-galactosidase assay was performed. Positive clones were recorded for both reporter gene activity (his and beta-galactosidase), fish plasmids were isolated from yeast, transformed into E. coli strain KC8, the DNA plasmids purified, and the resulting plasmids conventionally It was sequenced by the method [Sanger F. et al. (1997) PNAS, 74: 5463-67].
[382] Specificity test
[383] Binding specificity tests of positive interactor clones were performed, where they are described in Fineley R.L. Jr. et al. (1994) PNAS, 91 (26): 12980-12984, are exposed to a panel of related and unrelated baits by the mating scheme described. In summary, positive fish plasmids were transformed into Y187 and a panel of baits was transformed into HF7c. Transformed fish and bait cells were streaked on selection media plates, bound on YPAD plates and tested for reporter gene activity.
[384] analysis
[385] PCIP nucleotides were synthesized using the BLASTN 1.4.8MP program [Altschul et al. (1990) Basic Local Alignment Search Tool. J. Mol. Biol. 215: 403-410] for nucleic acid hits. PCIP proteins were analyzed for polypeptide hits with the BLASTN 1.4.9MP program.
[386] Electrophysiology Method
[387] Mammalian In Vivo Research
[388] HEK 293 and CHO cells were transiently transfected and used for 1-3 days for recording. Total cell current was recorded from cells expressing GFP identified by green fluorescence. The electrode (Sutter Instrument Co. Novato, CA) withdrawn from the filamentated borosilicate glass was given an initial resistance of 3-5 kPa. After access to the gigaseal and ruptured whole cell composition, the resistance was less than 10 kPa. Whole cell bath solution was prepared from 10 × Hank balanced salt solution with the following final concentration (mM): 138 NaCl, 5.4 KCl, 1.3 MgCl ₂ , 1.3 CaCl ₂ , 5.5 D-Glukos and 10 HEPES, pH 7.4. Intracellular electrode solution (in mM) consists of 140 KCl, 10 HEPES, 10 EGTA, 0.5 MgCl ₂ , pH 7.3. All chemicals were purchased from Sigma (St. Louis, MO) or Fisher Scientific, TX. Membrane currents were recorded using an EPC9 patch-clamp amplifier (HEKA, Germany). Data was analyzed using Matlab (Natick, Ma) and leakage was subtracted if necessary. All experiments were performed at room temperature.
[389] Xenopus oocyte research
[390] The frog was operated two or more times and the surgery was performed with well established techniques. Total cRNA (1-10 ng) was injected into the Xenopus oocytes of stage IV harvested the previous day. Preparatory oocytes were cultured in ND96 at pH 7.6 containing 96 NaCl, 2 KCl, 1.8 CaCl ₂ , 1 MgCl ₂ , 5 HEPES in addition to (gentamicin 50 μg / ml) at 18 ° C. Xenopus oocytes were studied for 3-7 days after injection. Two electrode voltage clamp recordings were performed in ND96 solution using a Turbotek 03 clamp amplifier (ALA Scientific Instruments, Westbury, NY). Both electrodes were charged with 3M KCl and the electrode resistance was maintained at 0.2-1 kPa. The current signal was filtered at 1000 Hz using pulse software (HEKA, Germany) before being delivered to the PC (Gateway, CA).
[391] Example 1 Identification of Rat PCIP cDNA
[392] Kv4.3 gene coding sequence (for the initial 180 amino acid coding) was amplified by PCR and cloned into pGBT9 to generate GAL4 DNA-binding domain-Kv4.3 (1-180) gene fusion (plasmid pFWA2). HF7c was transformed with this construct. The resulting strains were grown in synthetic complete medium lacking L-tryptophan in the presence of 10 mm 3-AT, but not in synthetic complete medium lacking L-tryptophan and L-histidine, which was {GAL4 DNA-binding domain}-{ vKv4.3 (1-180)} demonstrates that gene fusions do not have endogenous transcriptional activation activity greater than the threshold allowed by 10 mM 3-AT.
[393] In this example, a yeast two-hybrid assay was performed, wherein a plasmid containing the {GAL4 DNA-binding domain}-{rKv4.3 (1-180)} fusion was transferred into the yeast two-hybrid screening strain HF7c. Introduced. HF7c was then transformed with rat midbrain 2-hybrid library. About 6 million transformants were obtained and plated in selection medium. Colonies growing in selection medium and expressing beta-galactosidase reporter genes were further characterized for retransformation and specificity assays. Retransformation and specificity assays yielded three PCIP clones (rats 1v, 8t and 9qm) capable of binding to Kv4.3 polypeptides.
[394] The full length sequence of the rat 1v gene and the partial sequences of the 8t and 9qm genes were derived as follows. Probes were prepared using partial rat PCIP sequences and used, for example, for screening rat midbrain cDNA libraries. Positive clones were identified, amplified and sequenced using standard techniques to obtain full length sequences. In addition, the existing rat PCIP cDNA ends were amplified at high speed (eg, using 5'RACE by Gibco, BRL) to complete the 5 'end of the transcript.
[395] Example 2: Identification of Human 1v cDNA
[396] To obtain human 1v nucleic acid molecules, cDNA libraries prepared from human hippocampus (Clontech, Palo Alto, Calif.) Were screened under the following less stringent conditions: prehybridization at 42 ° C. for 4 hours in Clontech Express Hyb solution. And hybridized overnight at 42 ° C. The probe used was a PCR generated fragment comprising nucleotides 49-711 in a rat sequence labeled with ³² P dCTP. The filter was washed 6 times in 2XSSC / 0.1% SDS at 55 ° C. The same conditions were used for the second screening of the positive isolates. The clones thus obtained were sequenced using an ABI automated DNA sequencing system and compared with the rat sequences shown in SEQ ID NO: 3 as well as known sequences from the Genbank database. Longest clones from the library screens were subsequently subcloned into pBS-KS + (Stratagene, La Jolla, Calif.) To identify sequences. The 515 base pair clones were determined to represent the human homologs of the 1v gene, which included 211 base pairs and 304 base pair coding regions of 5 'UTR. To generate full length cDNA, 3 'RACE was used according to the manufacturer's instructions (Clontech Advantage PCR kit).
[397] Example 3: Isolation and Characterization of 1v Splice Variants
[398] Mouse 1v shown in SEQ ID NO: 5 and rat 1vl splice variant shown in SEQ ID NO: 7 were isolated using the two-hybrid assay described in Example 1. Mouse 1 vl splice variants shown in SEQID NO: 7 were isolated by screening mouse brain cDNA libraries, and rat 1v splice variants shown in SEQ ID NO: 11 were isolated using BLAST search.
[399] Example 4 Isolation and Identification of 9Q and Other PCIPs
[400] Rat 9ql (SEQ ID NO: 15) is isolated by database mining, rat 9qm (SEQ ID NO: 21) is isolated by 2-hybrid assay, and rat 9qc (SEQ ID NO: 27) is database mining It was identified as. Human 9ql (SEQ ID NO: 13), and human 9qs (SEQ ID NO: 23) were identified as described in Example 2. Mouse 9ql (SEQ ID NO: 17), Monkey 9qs (SEQ ID NO: 25), Human p193 (SEQ ID NO: 39), Rat p19 (SEQ ID NO: 33), and Mouse p19 (SEQ ID NO: 35) Was identified by database mining. Rat 8t (SEQ ID NO: 29) was identified using a 2-hybrid assay. The sequence of W28559 (SEQ ID NO: 37) was identified by database mining and sequencing of the EST identified by Genebank Search No. AI352454. The protein sequence was found to contain 41 amino acid regions with strong homology with 1v, 9ql and p19. However, downstream of this homology region, the sequence deviated from that of the PCIP family. This sequence may represent a gene with a 41 amino acid domain that is homologous to similar domains found in PCIP family members.
[401] Human genome 9q sequences (SEQ ID NOs: 46 and 47) were isolated by screening BAC genomic DNA libraries (Reasearch Genetics) using primers designed based on the sequences of human 9qm cDNA. Two positive clones were identified (448O2 and 721I17) and sequenced.
[402] Example 5: Expression of 1V, 8T and 9Q mRNA in Rat Tissues
[403] Rat and mouse multiple tissue Northern blots (Clontech) were directed to the 5'-untranslated and 5'-coding regions of the rat 1v sequence (nucleotides 35-124; SEQ ID NO: 3) (this probe is rat 1v and 1vl). Specific), directed to the 5 'coating region of the 8t sequence (nucleotides 1-88; SEQ ID NO: 29) (this probe is specific for 8t), or rat 9qm sequence (nucleotides 1-195; SEQ ID NO: 21) was probed with a [ ³² P] -labeled cDNA probe pointing to the 5 'end (this probe is specific for all 9q isoforms except 8t). Blots were hybridized using standard techniques. Northern blon hybridized with rat 1v probe showed a single band at 2.3 kb only in lanes containing brain RNA, suggesting that 1v expression is brain specific. Northern blots probed with rat 8t probe showed the major band at 2.4 kb. The rat 8t band is the strongest in lanes containing cardiac RNA, and also the weaker bands in lanes containing brain RNA. Northern blots hybridized with 9q cDNA probes show major bands at 2.5 kb with significant expression in brain and heart, and small bands above 4 kb. Small bands indicate incompletely sliced or processed 9q mRNA. The results from the northern blots further suggest that p19 is significantly expressed in the heart.
[404] Example 6: Expression of 1V, 8T and 9Q in Brain
[405] Expression of rat 1v and 8t / 9q in the brain is described in [ ³⁵ S] -labeled cRNA probes and in Rhodes et al. (1996) J. Neurosci., 16: 4846-4860, observed in vivo hybridization histochemistry (ISHH) using the same hybridization procedure as described. Templates for preparing cRNA probes were generated by standard PCR methods. In summary, oligonucleotide primers were designed to amplify fragments of the 3'- or 5'-untranslated region of the target cDNA, and also to add promoter recognition sequences for T7 and T3 polymerases. Thus, the following primers were used to generate 300 nucleotide probes directed to the 3'-untranslated region of 1v mRNA:
[406] 5- TAATACGACTCACTATAGGG ACTGGCCATCCTGCTCTCAG-3 ( T7 , Forward, Sense; SEQ ID NO: 42)
[407] 5- ATTAACCCTCACTAAAGGGA CACTACTGTTTAAGCTCAAG-3 ( T3 , reverse, antisense; SEQ ID NO: 43). Underlined bases correspond to the T7 and T3 promoter sequences. To generate probes directed to the 325 bp region of the 3'-untranslated sequence shared by 8t and 9q mRNAs, the following primers were used:
[408] 5- TAATACGACTCACTATTAGGG CACCTCCCCTCCGGCTGTTC-3 ( T7 , Forward, Sense; SEQ ID NO: 44)
[409] 5- ATTAACCCTCACTAAAGGGA GAGCAGCAGCATGGCAGGGT-3 ( T3 , reverse, antisense; SEQ ID NO: 45).
[410] Autoradiography of rat brain tissue sections treated to ISHH localize 1v or 8t / 9q mRNA expression indicates that 1v mRNA is widely expressed in the brain in a pattern consistent with the labeling of neurons as opposed to glial or endothelial cells. 1v mRNA is highly expressed in the cortex, spongy and progenitor intermediate neurons, reticulum of the thalamus, medial rein, and cerebellar granule cells. 1v mRNA is expressed moderately in the midbrain nucleus, including melanoma and superior colliculus, in many other thalamic nuclei, and in the medial septum and diagonal fibrillary nucleus of the basal forebrain.
[411] Since the probe used to analyze the expression of 8t and 9q hybridizes in the same 3-untranslated region as in 8t and 9q mRNA, this probe produces a composite image, which indicates that 8t / 9q mRNA is described above. It is widely expressed in the brain in a pattern partially overlapping with the part for 1v. However, 8t / 9q mRNA is highly expressed in striatum, hippocampus, cerebellar granule cells, and neocortex. 8t / 9q mRNA is expressed moderately in the middle brain, thalamus and brain stem. In many of these areas, 8t / 9q mRNA appears to be concentrated in intermediate neurons in addition to main cells, and in all areas 8t / 9q expression appears to be concentrated in neurons alongside glial cells.
[412] Single- and double-label immunohistochemistry shows that PCIP and Kv4 polypeptides are colocalized correctly in many cell types and brain regions and that PCIP and Kv4 mRNAs are coexpressed. For example, 9qm colocalizes with neurons in Kv4.2 in the trunk and dendrite of hippocampal granules and pyramidal cells, and in neuronal cells in the middle renal nucleus and cerebellar basket, whereas 1v is a layer II neuron in the posterior cingulate cortex. Internally, co-located with Kv4.3 within the cavernous intermediate neuron and in a subset of cerebellar granule cells. Immunoprecipitation assays show that 1v and 9qm coassociate with Kv4 α-subunits in the rat meninges.
[413] Example 7: Co-Binding of PCIP and Kv4 Channels in COS and CHO Cells
[414] C0S1 and CHO cells were individually bound to individual PCIPs (KChIP1, KChIP2, KChIP3), either alone or in combination with Kv4.2 or Kv4.3 using lipofectamine, in addition to the procedures described by the Boehringer Mannheim. Transient transfection. 48 hours after transfection, cells were washed, fixed and treated for immunofluorescence visualization as above (Bekele-Arcuri et al. (1996) Neuropharmacology, 35: 851-865). Affinity-purified rabbit polyclonal or mouse monoclonal antibodies to Kv4 channel or PCIP proteins were used for immunofluorescence detection of target proteins.
[415] When expressed alone, PCIP diffuses and distributes throughout the cytoplasm of COS-1 and CHO cells, as expected for cytoplasmic proteins. In contrast, when expressed alone, Kv4.2 and Kv4.3 polypeptides are concentrated in the nucleus ER and Golgi compartments, and some immune responses are concentrated in the outer pods of the cell. When PCIP is coexpressed with Kv4 α-subunits, the characteristic PCIP diffusion distribution changes dramatically and PCIP co-expresses with Kv4 α-subunits accurately. This redistribution of PCIP does not occur when they coexpress with Kv1.4 α-subunits, indicating that altered PCIP localization is not the result of overexpression and that these PCIPs specifically bind to Kv4-family α-subunits. Indicates.
[416] Mutual immunoprecipitation assays were performed using the PCIP and channel-specific antibodies to demonstrate that PCIP and Kv4 polypeptides are not simply colocalized within tightly bound and co-transfected cells. The ability of anti-Kv4.2 and anti-Kv4.3 antibodies to immunoprecipitate KChIP1, KChIP2 and KChIP3 proteins from lysates prepared from coated cells and Kv4.2 and Kv4.3 α- from these same lysates As evidenced by the ability of anti-PCIP antibodies to immunoprecipitate subunits, all three PCIP polypeptides were co-associated with Kv4 α-subunits in the transfected cells. Cells were lysed in buffer containing detergent and protease inhibitors and prepared for immunoprecipitation reactions as essentially known (Nakahira et al. (1996) J. Biol. Chem., 271: 7084-7089). Immunoprecipitation is described by Nakahira et al. (1996) J. Biol. Chem., 271: 7084-7089) and Harlow E. and Lane, D., Antibodies: A Laboratory Manual, Cold Spring Harbor Laboratory, c1988. It was. Products generated from immunoprecipitation were size fractionated by SDS-PAGE and transferred to nitrocellulose filters using standard procedures.
[417] To confirm that the cytoplasmic N-terminus of the Kv4 channel is sufficient for interaction with PCIP, KChIP1 or KChIP2 was combined with a Kv4.3 mutant (Kv4.3ΔC) lacking a total of 219 amino acid cytoplasmic C-terminal tails. Co-expressed. For transient transfected COS-1 cells, Kv4.3ΔC mutants were extensively trapped in the peri nuclear ER and Golgi: little or no staining at the outer edges of the cells was observed. It wasn't. Nevertheless, KChIP1 and KChIP2 colocalized correctly with Kv4.3ΔC in coat-transfected cells, and furthermore, Kv4.3ΔC was coimmunoprecipitated efficiently by PCIP antibodies, which is PCPC and Kv4 α-sub The interaction of the units does not require the cytoplasmic C-terminus of the channel.
[418] Example 8: Coupling of PCIP and Kv4 Channels in Natural Tissues
[419] To determine if PCIP is colocalized with and co-coupled with Kv4 in natural tissues, Kv4- and PCIP-specific antibodies were subjected to single- and double-label immunohistochemical and mutual coimmunoprecipitation analysis of the rat meninges. Used. Immunohistochemical staining of rat brain sections showed that KChIP1 and KChIP2 colocalized with Kv4.2 and Kv4.3 in a region and cell type specific manner. For example, KChIP1 has been colocalized with Kv4.3 at the synaptic arrangement and mossy fiber ends between the dendritic and Golgi cells of the cerebellar basket, the hippocampal mesenchymal neurons, cerebellar granulocytes (glomeruli). KChIP2 has been colocalized with Kv4.3 and Kv4.2 in several subcortical structures, including dendrites of granular cells in the dentate gyrus, apical and basal dendrites of hippocampal and neocortical pyramidal cells, and striatum and superspheres. Coimmunoprecipitation analyzes performed using synaptic membranes prepared from whole rat brains showed that PCIP (KChIP 1, 2 and 3) is tightly coupled with Kv4.2 and Kv4.3 in the brain K ⁺ channel complex. Anti-PCIP antibodies immunoprecipitated Kv4.2 and Kv4.3 from the meninges and anti-Kv4.2 and Kv4.3 antibodies immunoprecipitated PCIP. None of the PCIP polypeptides were immunoprecipitated by the anti-Kv2.1 antibodies, indicating that the binding of this PCIP to brain Kv channels may be specific for Kv4 α-subunits. Taken together, these anatomical and biochemical analyzes indicate that this PCIP is a component of the native Kv4 channel complex.
[420] Example 9: PCIP as a Calcium Binding Protein
[421] To determine if KChIP 1, 2 and 3 bind Ca ²⁺ , a GST fusion protein was generated for each PCIP, and the GST-PCIP protein as well as the recombinant PCIP polypeptide enzymatically cleaved from GST bound ⁴⁵ Ca ²⁺ The ability to do this was investigated using a filter overlay assay (Kobayashi et al. (1993) Biochem. Biophys. Res. Commun. 189 (1): 511-7). All three PCIP polypeptides that are not unrelated GST fusion proteins exhibit strong ⁴⁵ Ca ²⁺ binding in this assay. Moreover, all three PCIP polypeptides exhibit Ca ²⁺ dependent shift displacement on SDS-PAGE, indicating that KChIP 1, 2 and 3 are indeed Ca ²⁺ binding proteins, as with other members of this family (Kobuyashi et al. (1993) supra; Buxbaum et al. Nef (1996). Neuron-specific calcium sensors (the NCS-1 subfamily) .In: Celio MR (ed) Guidebook to the calcium-binding proteins.Oxford University Press, New York Buxbaum JD, et al. (1998) Nature Med. 4 (10): 1177-81).
[422] Example 10 Electrophysiological Characterization of PCIP
[423] Since PCIPs such as KChIP1 (1v), KChIP2 (9ql), and KChIP3 (p19) are colocalized and co-coupled with Kv4 α-subunits in the brain, another important problem is that these PCIPs are responsible for the conduction characteristics of Kv4 channels. It was decided whether to change. To solve this problem, Kv4.2 and Kv4.3 were expressed alone and in combination with individual PCIPs. CHO cells were transiently transfected with cDNA using the DOTAP lipofection method described by the manufacturer (Boehringer Mannheim, Inc.). Transfected cells were identified by coatfection of enhanced GFP with the gene of interest and then determining if the cells contained green GFP fluorescence. Current in CHO cells was measured using the patch-clamp technique (Hamill et al. 1981. Pfluegers Arch. 391: 85-100).
[424] Transient transfection of rat Kv4.2 α-subunits in CHO cells produced expression of typical A-type K + conductivity. Co-expression of Kv4.2 and KChIP1 showed some significant effects of KChIP1 on the channel (FIG. 41 and Table 1). First, the magnitude of Kv4.2 current increased approximately 7.5-fold in the presence of KChIP1 (size of Kv4.2 alone = 0.60 +/− 0.096 nA / cell; Kv4.2 + KChIP1 = 4.5 +/− 0.55 nA / cell ). When converting measurements of cell surface membrane area to current density by correcting for cell capacitance, Kv4.2 current density increased 12-fold with co-expression of KChIP1 (Kv4.2 alone = 25.5 +/- 3.2 pA / pF; Kv4.2 + KChIP1 = 306.9 +/- 57.9 pA / pF), indicating that KChIP promotes and / or stabilizes Kv4.2 surface expression. With this increase in current density, a significant leftward displacement of the threshold for activation of Kv4.2 current was observed in cells expressing Kv4.2 and KChIP1 (activation V1 / 2 = 20.8 + // for Kv4.2 alone). 7.0 mV, Kv4.2 + KChIP1 = -12.1 +/- 1.4 mV). Finally, the kinetics of Kv4.2 deactivation is significantly slowed down when Kv4.2 is coexpressed with KChIP1 (Kv4.2 deactivation time constant = 28.2 +/- 2.6 ms; Kv4.2 + KChIP1 = 104.1 + /) 10.4 ms), the channel expresses both Kv4.2 and KChIP1 (recovery tau = 53.6 +/- 7.6 ms) compared to cells expressing Kv4.2 alone (recovery tau = 272.2 +/- 26.1 ms). Recovered from deactivation much faster.
[425] KChIP 1, 2 and 3 have unique N-terminus but share significant amino acid identity within the C-terminal "core" domain. Despite this unique N-terminus, the effects of KChIP2 and KChIP3 on Kv4.2 current density and kinetics were remarkably similar to the effects produced by KChIP1 (Table 1). Thus, to confirm that conserved C-terminal core domains containing all three EF-hands are sufficient to control Kv4 current density and kinetics, N-terminal truncation mutants of KChIP1 and KChIP2 were prepared. . KChIP1ΔN2-31 and KChIP2ΔN2-67 mutants are KChIP1 and KChIP2 truncated for the C-terminal 185 amino acid core sequence, respectively. Co-expression of KChIP1ΔN2-31 or KChIP2ΔN2-67 with kv4.2 in CHO cells produced changes in Kv4.2 current density and kinetics indistinguishable from the effects produced by full-length KChIP1 or KChIP2 (Table 1).
[426] To investigate whether this regulatory effect of KChIP is specific for Kv4 channels, KChIP1 was co-expressed with Kv1.4 and Kv2.1 in Xenopus oocytes. Xenopus oocytes were injected with 1-3ng cRNA per oocyte prepared using standard in vitro transcription techniques (Sambrook et al. 1989. Molecular Cloning: a laboratory manual, Cold Spring Harbor Press). The current in Xenopus oocytes was measured by a two-electrode voltage clamp. KChIP1 was considered to have no effect on Kv1.4 or Kv2.1 currents (Table 2), indicating that this functional effect may be specific for Kv4 channels. The kinetic analysis was repeated after Kv4.3 and KChIP mRNA expression in Xenopus oocytes as a final control for the KChIP effect and to demonstrate that the effect of KChIP on Kv4 current is independent of the expression system. The effect of KChIP1 on Kv4.3 in the Xenopus oocyte system was markedly similar to the effect on Kv4.2 in CHO cells (Table 1).
[427] Since this KChIP binds to Ca2 +, another important problem is to determine if KChIP1's effect on Kv4.2 current is Ca2 + dependent. This problem was solved indirectly by introducing a point mutation in the EF-hand domain of each KChIP: one mutant had a point mutation in the first two EF hands (D ₁₉₉ → A, G ₁₀₄ → A, D ₁₃₅ → A and G ₁₄₀ → A) and the other carry point mutations in all three EF hands (D ₁₉₉ → A, G ₁₀₄ → A, D ₁₃₅ → A, G ₁₄₀ → A, D ₁₈₃ → A and G ₁₈₈ → A). This mutation replaced the two most highly conserved amino acids with alanine within the EF-hand consensus (FIG. 25: Linse, S and Forsen, S. (1995) Determinants that govern high-affinity Calcium binding. In Means, S. (Ed.) Advances in second messenger and phosphoprotein research.New York, Ravens Press., 30: 89-150. Co-expression of these KChIP1 triple EF-hand mutants with Kv4.2 or Kv4.3 in COS cells indicates that these mutants colocalize and efficiently coimmunoprecipitate with Kv4 α-subunits in COS-1 cells. Indicated. However, this EF-hand point mutation completely eliminated the effect of KChIP1 on Kv4.2 kinetics (Table 1). Taken together, these results indicate that the binding interaction between KChIP1 and Kv4.2 is Ca2 + independent, whereas the regulation of Kv4.2 kinetics by KChIP1 is either Ca2 + dependent or structural changes induced by point mutations within the EF-hand domain. It is sensitive to.
[428] Functional Effects of KchIP on Kv4 Channels Current parameter rKv4.2 + vector rKv4.2 + KchIP1 rKv4.2 + KchIP1 ΔN2-31 rKv4.2 + KchIP2 rKv4.2 + KchIP2 ΔN2-67 rKv4.2 + KchIP3 rKv4.3 rKv4.3 + KchIP1 Peak current (nA / cell at 50 MV) 0.60 ^* ± 0.096 4.5 ^* ± 0.055 6.0 ^* ± 1.1 3.3 ^* ± 0.45 5.8 ^* ± 1.1 3.5 ^* ± 0.99 7.7㎂ ± 2.6 18.1㎂ ^* ± 3.8 Peak Current Density (pA / pF at 50mV) 25.5 ± 3.2 306.9 ^* ± 57.9 407.2 ^* ± 104.8 196.6 ^* ± 26.6 202.6 ^* ± 27.5 161.7 ^* ± 21.8 … … Inactivity time constant (ms, at 50 mV) 28.2 ± 2.6 104.1 ± 10.4 129.2 ± 14.2 95.1 ^* ± 8.3 109.5 ^* ± 9.6 67.2 ^* ± 14.1 56.3 ± 6.6 135.0 ± 15.1 Recovery time constant from deactivation 272.2 53.6 ^* 98.1 ^* 49.5 ^* 36.1 ^* 126.1 ^* 327.0 34.5 ^** Significantly different from the control
[429] Functional Effects of KChIP on Other Kv ChannelsOocytes Oocytes Current parameters HKv1.4 hKv1.4 + 1v HKv2.1 HKv2.1 + 1v Peak current 8.3 6.5 3.7 2.9 (Cell / cell at 50 MV) ± 2.0 ± 0.64 ± 0.48 ± 0.37 Inactivity time constant 53.2 58.2 1.9 s 1.7 s (at 50 mV, ms) ± 2.8 6.6 ± ± 0.079 0.078 Recovery time constant from deactivation (at sec, -80 mV) 1.9 1.6 7.6 7.7 Activation V _1/2 (mV) -21.0 -20.9 12.0 12.4 Steady state deactivation V1 / 2 (mV) -48.1 -47.5 -25.3 -23.9
[430] Example 11: Effect of KChIP1 on Surface Expression of Kv4-α Subunits in COS-1 Cells
[431] To investigate the ability of KChIP1 to enhance surface expression of Kv4 channels, the ability of KChIP1 to promote the formation of co-clusters of Kv4 channels and PSD-95 was monitored. PSD-95 is used to facilitate visualization of the complex.
[432] To facilitate the interaction between Kv4.3 and PSD-95, a chimeric Kv4.3 subunit (Kv4.3ch) was generated, wherein the C-terminal 10 amino acids from rKv1.4 (SNAKAVETDV, SEQ ID NO: 73) was added to the C-terminus of Kv4.3. C-terminal ten amino acids from rKv1.4 were used, which gave Kv4.3 protein the ability to bind PSD-95 and to bind PSD-95 when fused to Kv4.3 C-terminus. Because it is. Expression of Kv4.3ch in COS-1 indicated that Kv4.3ch polypeptide was trapped in the cytoplasm of the nucleus with minimal detectable Kv4.3ch immunoreactivity at the outer edge of the cell. When Kv4.3ch co-expressed with PSD-95, PSD-95 was trapped in the nuclear cytoplasm and colocalized with Kv4.3ch. However, when KChIP1 coexpressed with Kv4.3ch and PSD-95, huge plaque-like surface co-clusters of Kv4.3ch, KChIP1 and PSD-95 were observed. Triple-labeled immunofluorescence confirmed that these surface clusters contained all three polypeptides, and mutual coimmunoprecipitation analysis indicated that the three polypeptides were covalently bound to these surface clusters. Control experiments showed that KChIP1 did not interact with PSD-95 alone and did not colocalize with Kv1.4 and PSD-95 in surface clusters. Taken together, these data indicate that KChIP1 can promote the transport of Kv4.3 subunits to the cell surface.
[433] Example 12 Characterization of PCIP Proteins
[434] In this example, the amino acid sequences of the PCIP proteins were compared with the amino acid sequences of known proteins and various motifs were identified.
[435] The 1v polypeptide whose amino acid sequence is shown in SEQ ID NO: 3 is a novel polypeptide comprising 216 amino acid residues. Domains suspected to be involved in calcium binding (Linse, S. and Forsen, S. (1995) Advances in Second Messenger and Phosphoprotein Research 30, Chapter 3, p89-151, edited by Means, AR., Raven Press, Ltd. , New York) was identified by sequence alignment (see FIG. 21).
[436] The 8t polypeptide, whose amino acid sequence is shown in SEQ ID NO: 30, is a novel polypeptide comprising 225 amino acid residues. Calcium binding domains presumed to be involved in calcium binding (Linse, S. and Forsen, S. (1995) Advances in Second Messenger and Phosphoprotein Research 30, Chapter 3, p89-151, edited byMeans, AR., Raven Press, Ltd , New York) was identified by sequence alignment (see Figure 21).
[437] 9q polypeptide is a calcium binding domain (Linse, S. and Forsen, S. (1995) Advances in Second Messenger and Phosphoprotein Research 30, Chapter 3, p89-151, edited by Means, AR., Raven Press, Ltd., New York) (see FIG. 21).
[438] The p19 polypeptide is a calcium binding domain that is believed to be involved in calcium binding (Linse, S. and Forsen, S. (1995) Advances in Second Messenger and Phosphoprotein Research 30, Chapter 3, p89-151, edited by Means, AR., Raven Press, Ltd., New York) (see FIG. 21).
[439] BLASTN 2.0.7 search (Altschul et al. (1990) J. Mol. Biol. 215: 403) of the nucleotide sequence of rat 1v1 showed that rat 1vl was similar to rat cDNA clone RMUAH89 (Accession No. AA849706). The rat 1 vl nucleic acid molecule is 98% identical to the rat cDNA clone RMUAH89 (Accession AA849706) over nucleotides 1063 to 1488.
[440] BLASTN 2.0.7 search of the nucleotide sequence of human 9ql (Altschul et al. (1990) J. Mol. Biol. 215: 403) showed that human 9ql was similar to human cDNA clone 1309405 (Accession No. AA757119). Human 9ql nucleic acid molecules are 98% identical to human cDNA clone 1309405 (Accession AA757119) over nucleotides 937-1405.
[441] BLASTN 2.0.7 search of the nucleotide sequence of mouse P19 (Altschul et al. (1990) J. Mol. Biol. 215: 403) shows that mouse P19 is similar to Mus muscle cDNA clone MNCb-7005 (Accession No. AU035979). It was. The mouse P19 nucleic acid molecule is 98% identical to Mus muscle cDNA clone MNCb-7005 (Accession AU035979) over nucleotides 1-583.
[442] Example 13: Expression of Recombinant PCIP Protein in Bacterial Cells
[443] In this example, PCIP is expressed as a recombinant glutathione-S-transferase (GST) fusion polypeptide in E. coli, and the fusion polypeptide is isolated and characterized. Specifically, PCIP is fused to GST and this fusion polypeptide is expressed in E. coli, for example strain BI21. Expression of the GST-PCIP fusion protein in BI21 was induced using IPTG. Recombinant fusion polypeptides were purified by affinity chromatography on glutathione beads from crude bacterial lysates of the derived BI21 strain. Polyacrylamide gel electrophoresis analysis of polypeptides purified from bacterial lysates was used to determine the molecular weight of the resulting fusion polypeptide.
[444] Rats 1v and 9ql were cloned into pGEX-6p-2 (Pharmacia). The resulting recombinant fusion protein was expressed in E. coli and purified by performing methods known in the art (Current Protocols in Molecular Biology, eds. Ausubel et al. John Wiley & Sons: 1992). Identity of the purified proteins was confirmed by Western blot analysis using antibodies generated against peptide epitopes of rat 1v and 9ql.
[445] Example 14 Expression of Recombinant PCIP Protein in COS Cells
[446] To express PCIP genes in COS cells, pcDNA / Amp vectors (Invitrogen Corporation, San Diego, Calif.) Were used. This vector contains the SV40 replication origin, ampicillin resistant gene, E. coli replication origin, CMV promoter, polylinker region, and SV40 intron and polyadenylation sites in that order. Recombinant protein by cloning the DNA fragment encoding the complete PCIP protein and the HA tag (Wilson et al. (1984) Cell 37: 767) or FLAG tag frame-fused to the 3 'end of the fragment into the polylinker region of the vector. Ensure that the expression of is under the control of the CMV promoter.
[447] To construct the plasmid, the PCIP DNA sequence was amplified by PCR using two primers. The 5 'primer contains about 20 nucleotides of the PCIP coding sequence starting from the restriction site of interest following the start codon; The 3 'terminal sequence contains the last 20 nucleotides of the complementary sequence, translation end codon, HA tag or FLAG tag, and the PCIP coding sequence for other restriction sites of interest. PCR amplified fragments and pCDNA / Amp vectors were digested using suitable restriction enzymes and the vector was dephosphorylated using CIAP enzyme (New England Biolabs, Beverly, Mass.). Preferably, the two restriction sites selected were different such that the PCIP gene was inserted in the correct orientation. The ligation mixture is transformed into E. coli cells (strains HB101, DH5a, SURE available from Stratagene Cloning Systems, La Jolla, Calif. May be used), and the transformed culture is transferred onto ampicillin media plates. Plated and resistant colonies were selected. Plasmid DNA was isolated from the transformants and examined for the presence of the correct fragment by restriction analysis.
[448] COS cells were then transfected with PCIP-pcDNA / Amp plasmid DNA using calcium phosphate or calcium chloride coprecipitation, DEAE-dextran-mediated transfection, lipofection or electroporation. Other suitable methods for transfecting host cells are Sambrook, J. Chem. (Sambrook, J.), Frisch, Lee. Fritsh, EF and Maniatis, T. (Maniatis, T.), Molecular Cloning: A Laboratory Manual, 2nd, ed., Cold Spring Harbor Laboratory, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY, 1989. Expression of PCIP polypeptides is characterized by immunoprecipitation using radiolabels ( ³⁵ S-methionine or ³⁵ S-cysteine available from NEN (Boston, Mass.)) And HA specific monoclonal antibodies (Harlow, E. and Lane, D. Antibodies: A Laboratory Manual, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY, 1988). In summary, the cells were labeled for ³⁵ 8 hours S- methionine (or ³⁵ cysteine S-). Thereafter, the medium was collected and the cells were lysed using the washing agent (RIPA buffer, 150 mM NaCl, 1% NP-40, 0.1% SDS, 0.5% DOC, 50 mM Tris, pH 7.5). Both cell lysates and media precipitated with HA specific monoclonal antibodies. The precipitated polypeptide was then analyzed by SDS-PAGE.
[449] Alternatively, the DNA containing the PCIP coding sequence was cloned directly into the polylinker of the pCDNA / Amp vector using a suitable restriction site. The resulting plasmids were transfected into COS cells in the manner described above, and expression of PCIP polypeptide was detected by immunoprecipitation using radiolabeling and PCIP specific monoclonal antibodies.
[450] Rat 1v was cloned into mammalian expression vector pRBG4. Transfection into COS cells was performed using LipofectAmine Plus (Gibco BRL) according to the manufacturer's instructions. The expressed 1v protein was detected by immunocytochemistry and / or western blot analysis using antibodies generated against 1v in rabbits or mice.
[451] Example 15 Identification and Characterization of Human Full Length p19
[452] Human full-length p19 sequences were identified using RACE PCR. The sequence of p19 (also called KChIP3) is shown in FIG. 16. The amino acid sequence of human p19 was 92% identical to the mouse p19 gene (SEQ ID NO: 35).
[453] In the TBLASTN search using the protein sequence of human p19, human p19 has two sequences, Calsenenilin ((1998) Nature Medicine 4: 1177-1181] and DREAM [Ca of prodinorphin and c-fos transcription] ²⁺ -dependent modulators (Carrion et al. (1999) Nature 398: 80-84). Human p19 is 100% identical to calceniline at the nucleotide level (but extends 3 'to the published sequence) and 99% identical to DREAM at the nucleotide level.
[454] Northern blot, in situ hybridization, β-gal assay, DNA migration assay (see Carrion et al.) For the ability of p19 (as well as other PCIP family members) to co-localize with presenilin to act as transcription factors (1999) Nature 398: 80) and known techniques such as DNA transfer supershift assay using antibodies specific for KchIP.
[455] Another assay suitable for assessing the association of PCIP family members with prisenilin is co-immunoprecipitation (Buxbaum et al. (1998) Nature Medicine 4: 1177).
[456] Example 16: Identification and Characterization of Monkey KChIP4
[457] In this example, the identification and characterization of the genes encoding monkey KChIP4a (jlkbd352e01t1) and alternatively spliced monkey KChIP4b (jlkbb231c04t1), KChIP4c (jlkxa053c02) and KChIP4d (jlkx015b10) are described. Four clones, jlkbb231c04t1, jlkbd352e01t1, jlkxa053c02 and jlkx015b10, were identified through TBLASTN search in proprietary databases using sequences of known PCIP family members. The four monkey clones were obtained and sequenced.
[458] The sequences of the proprietary monkey clones jlkbb231c04t1 and jlkbd352e01t1 were found to correspond to alternatively spliced variants of an additional PCIP family member named herein as KChIP4. The clone jlkbb231c04t1 contained a 822 bp deletion site compared to jlkbd352e01t1 (presumably due to splicing removal of exons), resulting in the loss of the last EF hand domain. For clone jlkbd352e01t1, the last EF hand domain is conserved and the C-terminus is highly homologous to the C-terminus of PCIP family members 1v, 9ql and p19. The overall identity of homology C-terminus between KChIP4, 1v, 9ql and p19 ranged from 71% -80% at the amino acid level (alignment was done using CLUSTALW).
[459] The monkeys KChIP4c and KChIP4d were found by BLASTN search using the monkey KChIP4a as a query to search a proprietary database.
[460] The nucleotide sequence of monkey KChIP4a cDNA and the predicted amino acid sequence of KChIP4a polypeptide are shown in FIG. 23 and SEQ ID NO: 48 and SEQ ID NO: 49, respectively.
[461] The nucleotide sequence of the monkey KChIP4b cDNA and the predicted amino acid sequence of the KChIP4b polypeptide are shown in FIG. 24 and SEQ ID NO: 50 and SEQ ID NO: 51, respectively.
[462] The nucleotide sequence of the monkey KChIP4c cDNA and the predicted amino acid sequence of the KChIP4c polypeptide are shown in FIG. 35 and SEQ ID NO: 69 and SEQ ID NO: 70, respectively.
[463] The nucleotide sequence of monkey KChIP4d cDNA and the predicted amino acid sequence of KChIP4d polypeptide are shown in Figure 36 and SEQ ID NO: 71 and SEQ ID NO: 72, respectively.
[464] FIG. 37 shows the arrangement of protein sequences of KChIP4a, KChIP4b, KChIP4c and KChIP4d.
[465] As indicated by Northern blot experiments in which Northern blots purchased from Clontech were probed using DNA fragments from the 3'-untranslated region of rat KChIP4, rat KChIP4 is predominantly expressed in the brain and in the kidneys. It is weakly expressed but not in the heart, brain, spleen, lung, liver, skeletal muscle or testes.
[466] Example 17 Identification and Characterization of Humans and Rats 33b07
[467] In this example, the identification and characterization of genes encoding rat and human 33b07 are described. Partial rat 33b07 (clone name 9o) was isolated as a positive clone from the above-described yeast two-hybrid screening using rKv4.3N as bait. Full-length rat 33b07 clones were identified by mining a proprietary database.
[468] The nucleotide sequence of the full length rat 33b07 cDNA and the predicted amino acid sequence of the rat 33b07 polypebide are shown in FIG. 26 and SEQ ID NO: 52 and SEQ ID NO: 53, respectively. Rat 33b07 cDNA encodes a protein with a molecular weight of about 44.7 kD and is 407 amino acid residues in length.
[469] Rat 33b07 binds to rKv4.3N and rKv4.2N with a weak preference for rKv4.2N in the yeast two-hybrid assay. In contrast, rat 33b07 does not bind rKv1.1N, indicating that rat 33b07-Kv4N interaction is specific.
[470] Rat 33b07 is predominantly expressed in the brain as measured by Northern blot analysis.
[471] Human 33b07 ortholog (clone 106d5) was also identified by mining a proprietary database. The nucleotide sequence of the full length human 33b07 cDNA and the predicted amino acid sequence of the human 33b07 polypeptide are shown in FIG. 27 and SEQ ID NO: 54 and SEQ ID NO: 55, respectively. Human 33b07 cDNA encodes a protein having a molecular weight of about 45.1 kD, which is 414 amino acid residues in length.
[472] Human 33b07 is 99% identical to human KIAA0721 (GenBank Accession No .: AB018264) at the amino acid level. However, GenBank Accession No .: AB018264 does not have a functional comment. Human 33b07 is also homologous to testis-specific (Y-encoded) protein (TSP (Y)), SET and nucleosome assembly protein (NAP). Human 33b07 is 38% identical to human SET protein (GenBank Accession No. Q01105 = U51924) across amino acids 204-337 and 46% identical across amino acids 334-387.
[473] Human SET was also described as HLA-DR related protein II (PHAPII) [Hoppe-Seyler (1994) Biol. Chem. 375: 113-126, and in some cases it is associated with acute undifferentiated leukemia (AUL) as a result of translocation events leading to the formation of SET-CAN fusion genes (Von Lindern M. et al. (1992) Mol. Cell. Biol. 12: 3346-3355. An alternative spliced form of SET is also called template active factor-I alpha (TAF). TAF has been shown to be associated with myeloid leukemia induction. See Nagata K. et al. (1995) Proc. Natl. Acad. Sci. U.S.A. 92 (10), 4279-4283. Human SET is also a potent protein inhibitor of phosphatase 2A [Adachi Y. et al. (1994) J. Biol. Chem. 269: 2258-2262. NAP may be involved in the regulation of chromatin formation and may contribute to the regulation of cell proliferation. Simon H.U. et al. (1994) Biochem. J. 297, 389-397.
[474] Thus, 33b07 may function as a protein inhibitor of phosphatase, oncogenes and / or chromatin modulators due to its homology to the identified proteins. Of particular interest is the homology of 33b07 to SET, a protein phosphatase inhibitor. Many channels, particularly Kv4 channels (which 33b07 is associated with), have been found to be regulated by phosphorylation by PKC and PKA (see (1998) J. Neuroscience 18 (10): 3521-3528; Am J Physiol 273: H1775-86 (1997). Thus, 33b07 can modulate Kv4 activity by modulating the phosphorylation state of potassium channels.
[475] Example 18 Identification and Characterization of Rat 1p
[476] In this example, the identification and characterization of the gene encoding rat 1p is described. Partial rat 1p was isolated as positive clone from yeast two-hybrid screening described above using rKv4.3N as bait.
[477] The nucleotide sequence of the partial length rat 1p cDNA and the predicted amino acid sequence of the rat 1p polypeptide are shown in FIG. 28 and SEQ ID NO: 56 and SEQ ID NO: 57, respectively. Rat 1p cDNA encodes a protein with a molecular weight of about 28.6 kD and is 267 amino acid residues in length.
[478] Rat 1p binds to rKv4.3N and rKv4.2N with weak affinity for rKv4.3N in the yeast two-hybrid assay. In contrast, 1p does not bind rKv1.1N, indicating that the 1p-Kv4N interaction is specific.
[479] Rat 1p is predominantly expressed in the brain as determined by Northern blot analysis.
[480] 100 scores and 3 word lengths of the amino acid sequence of rat 1p [Altschul et al. (1990) J. Mol. Biol. 215: 403] and BLASTP 1.4 search revealed that rat 1p was identical to human Restin (Restin, GenBank Accession No. P30622; Cytoplasmic Linker Protein-170 Alpha-2 (CLIP-170), M97501) . Rat 1p protein is 58% identical to human lestin over amino acid residues 105-182, 55% identical to human lestin over amino acid residues 115-186, 22% identical to human lestin over amino acid residues 173-246, amino acid 22% identical to human lestin over residues 169-218 and 58% identical to human lestin over amino acid residues 217-228.
[481] Restin is also named Reed-Sternberg intermediate filament-related protein. Reid-Sternberg cells are tumor cells for diagnosing Hodgkin's disease. This suggests that lestin overexpression may be a contributing factor in the progression of Hodgkin's disease. Bilbe G. et al. (1992) EMBO J. 11: 2103-13] and Lestin seems to be an intermediate filament-related protein that links intracellular vesicles to microtubules [Pierre P, et al. (1992) Cell 70 (6), 887-900.
[482] The cytoskeleton is characterized by the activity of potassium channels. (1992) EMBO J. 11: 2465-2471 and Levin G, et al. (1996) J. Biol. Chem. 271: 29321-29328, as well as other channels, such as the Ca ⁺⁺ channel [Johnson BD et al. (1993) Neuron 10: 797-804; Or Na ⁺ channels [Fukuda J. et al. (1981) Nature 294: 82-85.
[483] Thus, based on its homology to the Lestin protein, the rat 1p protein can bind to the cytoskeleton and modulate the activity of potassium channels such as Kv4 through its binding to the cytoskeleton.
[484] Example 19 Identification and Characterization of Rat 7s
[485] In this example, the identification and characterization of the gene encoding rat 7s is described. Partial rat 7s were isolated as positive clones from the yeast two-hybrid screening described above using rKv4.3N as bait. Rat 7s are described, for example, in van Hille B. et al. (1993) J. Biol. Chem. 268 (10), 7075-7080, rat orthologs of the human fear H (+)-ATPase catalyst subunit A (Accession Nos. P38606 and B46091).
[486] The nucleotide sequence of the partial length rat 7s cDNA and the predicted amino acid sequence of the rat 7s polypeptide are shown in FIG. 29 and SEQ ID NO: 58 and SEQ ID NO: 59, respectively. Rat 7s cDNA is a protein with a molecular weight of about 28.6 kD and is 270 amino acid residues in length.
[487] Rat 7s binds to rKv4.3N and rKv4.2N with affinity for rKv4.3N in the yeast two-hybrid assay. In contrast, 7s does not bind rKv1.1N, indicating that the 7s-Kv4N interaction is specific.
[488] Rat 7s are expressed at significantly higher levels in the brain and kidney than in lung, liver, heart, testis and skeletal muscle as determined by Northern blot analysis.
[489] Example 20 Identification and Characterization of Rats 29x and 25r
[490] In this example, the identification and characterization of the gene encoding rat 29x is described. Rat 29x was isolated as a positive clone from yeast two-hybrid screening described above using rKv4.3N as bait. Rat 25r is a 29x splicing variant. They differ in the 5 'untranslated region but are identical at the coding region and amino acid level.
[491] The nucleotide sequence of rat 29x cDNA and the predicted amino acid sequence of rat 29x polypeptide are shown in FIG. 30 and SEQ ID NO: 60 and SEQ ID NO: 61, respectively. Rat 29xcDNA encodes a protein with a molecular weight of about 40.4 kD and is 351 amino acid residues in length.
[492] The nucleotide sequence of rat 25r cDNA is shown in FIG. 31 and SEQ ID NO: 62. Rat 25r cDNA encodes a protein with a molecular weight of about 40.4 kD and is 351 amino acid residues in length.
[493] Rat 29x is expressed in the spleen, lung, kidney, heart, brain, testes, skeletal muscle and liver, the highest level in the spleen and the lowest level in the liver.
[494] Rat 29x binds to rKv4.3N and rKv4.2N with weak affinity for rKv4.3N in the yeast two-hybrid assay. In contrast, 29x does not bind rKv1.1N, indicating that the 29x-Kv4N interaction is specific.
[495] Rat 29x is a rat SOCS-1 (suppressor of cytokine signaling) at the amino acid level [Starr R. et al. (1997) Nature 387: 917-921; JAB [Ref: Endo T.A. et al. (1997) Nature 387: 921-924; And SSI-1 (STAT-induced STAT inhibitor-1) [Naka T. et al. (1997) Nature 387: 924-928. The proteins are characterized by having an SH2 domain, which regulates cytokine signaling by binding to and inhibiting JAK kinases.
[496] As used herein, the term “SH2 domain” refers to an Src homologous 2 domain and includes a protein domain of about 100 amino acids in length that is associated with binding of phosphotyrosine residues, such as phosphotyrosine residues of other proteins. . The target site is called the SH2-binding site. The SH2 domain has a conserved 3D structure consisting of two alpha helices and six to seven beta-strands. The core of the SH2 domain is formed by successive bet-meanders consisting of two linked beta-sheets. Kuriyan J. et al. (1997) Curr. Opin. Struct. Biol. 3: 828-837. The SH2 domain functions as a regulatory module of the intracellular signaling cascade by interacting with high affinity with target peptides containing phosphotyrosine by sequence specific and strictly phosphorylation-dependent means. Pawson T. (1995) Nature 373 : 573-580]. Some proteins have multiple SH2 domains, which increase their affinity for binding to phosphate proteins or confer the ability to bind to different phosphate proteins. Rat 29x has the SH2 domain at amino acid residues 219-308 of SEQ ID NO: 61.
[497] Tyrosine phosphorylation regulates potassium channel activity. Prevarskaya N.B. et al. (1995) J. Biol. Chem. 270: 24292-24299. JAK kinase phosphorylates proteins in tyrosine and is involved in the regulation of channel activity (Prevarskaya N.B. et al. Supra). Thus, based on its homology to SOCS-1, JAB and SSI-1, rat 29x can modulate the activity of potassium channels such as Kv4 by modulating JAK kinase activity.
[498] Example 21 Identification and Characterization of Rat 5p
[499] In this example, the identification and characterization of the gene encoding rat 5p is described. Rat 5p was isolated as a positive clone from the yeast-2-hybrid screening described above using rKv4.3N as bait.
[500] The nucleotide sequence of rat 5p cDNA and the predicted amino acid sequence of rat 5p polypeptide are shown in FIG. 32 and SEQ ID NO: 63 and SEQ ID NO: 64, respectively. Rat 5p cDNA encodes a protein with a molecular weight of about 11.1 kD and is 95 amino acid residues in length.
[501] Rat 5p binds to rKv4.3N and rKv4.2N with similar intensity in the yeast two-hybrid assay. In contrast, 5p does not bind rKv1.1N, indicating that the 5p-Kv4N interaction is specific.
[502] Rat 5p is expressed in the spleen, lung, skeletal muscle, heart, kidney, brain, liver and testes as determined by Northern blot analysis.
[503] Rat 5p is identical to rat Calpactin I light chain or P10 (Accession No. P05943). P10 binds to Annexin II (p36) and induces its dimerization. P10 may function as a modulator of protein humanization when the p36 monomer is a preferential target of tyrosine-specific kinases. Masiakowski P. et al. (1998) Proc. Natl. Acad. Sci. U.S.A. 85 (4): 1277-1281.
[504] Tyrosine phosphorylation modulates the activity of potassium channels (Prevarskaya N.B. et al. Supra). Thus, due to its identity to P10, rat 5p can modulate the activity of potassium channels such as Kv4 by modulating the activity of tyrosine-specific kinases.
[505] Example 22: Identification and Characterization of Rat 7q
[506] In this example, the identification and characterization of the gene encoding rat 7q is described. Rat 7q was isolated as a positive clone from yeast two-hybrid screening described below using rKv4.3N as bait. Full length rat 7q was obtained by RACE PCR.
[507] The nucleotide sequence of rat 7q cDNA and the predicted amino acid sequence of rat 7q polypeptide are shown in Figure 33 and SEQ ID NO: 65 and SEQ ID NO: 66, respectively. Rat 7q cDNA encodes a protein having a molecular weight of about 23.5 kD, which is 212 amino acid residues in length.
[508] Rat 7q binds to rKv4.3N and rKv4.2N with the same intensity in the yeast two-hybrid assay. In contrast, 7q does not bind rKv1.1N, indicating that the 7q-Kv4N interaction is specific.
[509] Rat 7q is expressed in the heart, brain, spleen, lung, liver, skeletal muscle, kidney and testes as determined by Northern blot analysis.
[510] Rat 7q is identical to RAB2 (rat RAS-related protein, Accession No. P05712) at the amino acid level. RAB2 seems to be involved in vesicular transport and protein transport. Touchot N. et al. (1987) Proc. Natl. Acad. Sci. U.S.A. 84 (23): 8210-8214. Thus, based on its homology to RAB2, rat 7q can be associated with potassium channels such as Kv4 transport.
[511] Example 23 Identification and Characterization of Rat 19r
[512] In this example, the identification and characterization of the gene encoding rat 19r is described. Partial rat 19r was isolated as a positive clone from the yeast two-hybrid screening described above using rKv4.3N as bait. Full length rat 19r was obtained by RACE PCR.
[513] The nucleotide sequence of rat 19r cDNA and the predicted amino acid sequence of rat 19r polypeptide are shown in FIG. 34 and SEQ ID NO: 67 and SEQ ID NO: 68, respectively. Rat 19r cDNA encodes a protein having a molecular weight of about 31.9 kD, which is 271 amino acid residues in length.
[514] Rat 19r is expressed in the heart, brain, spleen, lung, liver, skeletal muscle, kidney and testes as determined by Northern blot analysis.
[515] Rat 19r binds to rKv4.3N and rKv4.2N with weak affinity for rKv4.3N in the yeast two-hybrid assay. In contrast, 19r does not bind rKv1.1N, indicating that the 19r-Kv4N interaction is specific.
[516] Rat 19r is described in Dickeson S.K. et al. (1989) J. Biol. Chem. 264: 16557-16564. Same as rat phosphatidylinositol (PTDINS) mobile protein alpha (PTDINSTP, accession no. M25758 or P16446). PTDINSTP is associated with phospholipase C-beta (PLC-beta) signaling, phosphatidylinositol transfer protein (PtdIns-TP) synthesis, secretory vesicle formation and enhancement of phosphatidylinositol 3-kinase (PtdIns 3-kinase) activity It is thought to have been found in Cunningham E. et al. (1995) Curr. Biol. 5 (7): 775-783; (1995) Nature 377 (6549): 544-547; and Panaretou C. et al. (1997) J. Biol. Chem. 272 (4): 2477-2485.
[517] Thus, based on PTDINSTP and homology thereof, rat 19r can modulate potassium channels such as Kv4 activity via PLC-beta signaling and / or PtdIns 3-kinase signaling pathways. Rat p19r may also be involved in potassium channels such as Kv4 transport.
[518] Example 24 Chromosome Positioning of Human 9q
[519] In this example, human PCIP 9q was chromosome mapped using a radiation hybrid panel (panel GB4). h9q was mapped to the region of chromosome 10q previously presented as being related to partial epilepsy named D10S192: 10q22-q24. Ottman et al. (1995) Nature Genetics 10: 56-60 (see FIG. 43). Based on this observation, the present invention clearly demonstrates that the 9q family of proteins can serve as targets for developing antiepileptic drugs and targets for medical interference of epilepsy.
[520] In addition, h9q was mapped to the region of chromosome 10q previously presented as being relevant to IOSCA, designated D10S192 and D10S1265: 10q24 (see Nikali, Genomics 39: 185-191 (1997)) (see FIGS. 42 and 43). ). Based on the above observations, the present invention clearly demonstrates that the 9q family of proteins can serve as targets for developing anti-cerebral ataxia drugs and as targets for medical interference of spinal cord cerebellar ataxia.
[521] Example 25 Arachidonic Acid Regulation of KV4 / KChIP Channels
[522] Kinetic regulation of Kv4 current by AA is KChIP-dependent
[523] Arachidonic acid (AA) has been shown to inhibit recombinant Kv4 current expressed in Xenopus oocytes (Vilarroel, A. and Schwarz, T. L., 1996, J. Neuroscience 16: 2522-32). However, regulation was only observed with peak current magnitudes and current kinetic parameters were not affected by the presence of AA. In contrast, recording of membrane patches obtained from hippocampal neurons showed that in addition to inhibition of peak size, AA altered the kinetic parameters of A-current by Kv4 channels. Keros, S. and McBain, CJ, 1997 , J. Neuroscience 17: 3476-87. Notably, the deactivation time constant was significantly reduced (note: the deactivation time constant correlates inversely with the deactivation rate). Thus, deactivation was accelerated (Keros, 1997 as above).
[524] In this example, the assumption that KChIP is a missing auxiliary subunit explaining the kinetic inconsistency is investigated by expressing Kv4 alone or with KChIP of both CHO cells and Xenopus oocytes, and measuring inactivation time constants. (See, eg, An et al., 2000, Nature 403: 553-6; Keros, S. and McBain, CJ, 1997; J. Neuroscience 17: 3476-87; and Villarroel, A. and Schwarz, TL, 1996, J. Neuroscience 16: 2522-32).
[525] Kinetic regulation of Kv4 by AA proved to be KChIP-dependent (Table 3). When Kv4.2 is expressed alone in CHO cells, the inactivation time constant of the generated current did not change in the absence or presence of 10 μM of AA (32 ± 3 vs 32 ± 2 milliseconds (ms) ± standard error Mean (SEM)). In contrast, when expressed with KChIP1, the inactivation time constant of Kv4.2 current decreased from 88 ± 8 ms in the absence of 10 μM AA to 37 ± 3 ms in the presence of AA. The results demonstrate that the kinetic regulation of Kv4 current by AA is dependent on the presence of KChIP. Similar results were obtained for KChIP1 (Table 4) and KChIP2 of Xenopus oocytes. The kinetic changes in Kv4 / KChIP in the presence of AA are consistent with those described in the neural membranes supporting that KChIP is an endogenous subunit of Kv4-based currents (Keros, 1997, same as above).
[526] AA can also be seen to inhibit the peak magnitude of Kv4 / KChIP currents in both CHO cells and Xenopus oocytes (Tables 3 and 4). This means that the adjustment of the peak magnitude of Kv4 current is independent of KChIP.
[527] AA Regulation of Kv4 and Kv4 / KChIP1 Currents in CHO CellsKv4.2 Kv4.2 KV4.2 / KChIP1 KV4.2 / KChIP1 0 μM AA 10 μM AA 0 μM AA 10 μM AA Inactivity time constant (ms ± SEM) 32 ± 3 32 ± 2 88 ± 8 37 ± 3 Peak magnitude (pA ± SEM) 620 ± 80 336 ± 82 4539 ± 448 2827 ± 496
[528] The arachidonic acid effect on A-current was also investigated in the nervous system (cultured primary cerebellar granule neurons) in which both Kv4 and KChIP are present. TEA (10 mM) was applied to block suspended external small components. Inactivation time constants of A current in the absence and presence of 10 μM arachidonic acid were 44 ± 5 ms and 21 ± 3 ms (mean ± SEM), respectively. The corresponding peak size was reduced from 2.0 ± 0.6 nA to 1.2 ± 0.4 nA. The results confirm that both Kv4 A-current magnitude and kinetics in native cells are regulated.
[529] Arachidonic acid regulation of Kv4 / KChIP currents is concentration-dependent and reversible
[530] The effect of different concentrations of arachidonic acid on Kv4 / KChIP currents was studied in xenopus oocytes. Since the physiological concentration of arachidonic acid is often less than 10 μM [Neeman, et al., 1986 Annu Rev Biochem 55: 69-102; Anderson and Welsh, 1990, Proc Natl Acad Sci USA 87: 7334-8; Meves 1994, Prog Neurobiol 43: 175-86], arachidonic acid was tested in the range of 1-10 μM. Concentration-dependent blocking of the peak magnitude of Kv4.3 current was independent of the presence of KChIP1 (see FIG. 64A). In addition, the slope of the magnitude reduction with increasing concentration was very similar in the presence and absence of KChIP. Peak current blocking did not appear to saturate to 10 μM. In Villarroel and Schwarz, 1996, J. Neurosci 16: 2522-32, the IC ₅₀ of arachidonic acid for Kv4α subunit was approximately 8 μM in oocytes. In the absence of KChIP1, the inactivation time constant did not change at all arachidonic acid concentrations tested. However, in the presence of KChIP1, the inactivation time constant decreased in concentration-dependent form (see Figure 64B).
[531] The onset of KChIP-dependent inert acceleration and KChIP-independent current blocking of Kv4.3 by 10 μM arachidonic acid was almost immediate (FIG. 65). A slight delay of at least a part (14 seconds) is due to the movement of the solution from the reservoir to the recording chamber. Size blockade progressed gradually over time (FIG. 65A). The presence of KChIP1 substantially did not change the percentage reduction or current blocking rate over time or the recovery rate of Kv4.3 current magnitude over time (FIG. 65B). When arachidonic acid was washed, the Kv4.3 current magnitude and inactivation time constants recovered completely at a similar rate in the presence of KChIP1 (compare FIG. 65A and 65B). Two small bends in the Kv4.3 alone plot in panel B are by buffer exchange.
[532] Regulation of Kv4 / KChIP by Other Fatty Acids
[533] In the past, certain fatty acids have been shown to mimic the effect of arachidonic acid on Kv4 currents in xenopus oocytes when Kv4α is expressed alone (Villarroel and Schwarz, J Neurosci 16: 2522-32,1996). As such, fatty acid selectivity against Kv4 current in the presence of KchIP was investigated. Arachidonic acid is a 20 carbon fatty acid with four cis double bonds having a first double bond at C5 (20: 4 c5). The following arachidonic acid analogs with distinct structural features were studied: γ-linolenic acid (18: 3 c9) has three cis double bonds instead of four double bonds, and linoleicidic acid (18: 2 t9) has four 4 trans double bonds instead of cis double bonds, 5,8,11,14-eicosatetrianoic acid (ETYA, 20: 4 n5) replaces double bonds expressed in arachidonic acid (ETI, 20: 3 n5) Has four triple bonds (n means the position of the first triple bond), and 5,8,11-eicosatrionic acid (ETI, 20: 3 n5) has three triple bonds. 66A shows that the peak magnitude of Kv4.3 current was significantly inhibited by γ-linoleic acid, ETI, ETYA and arachidonic acid 10 μM compared to the nonfatty acid control regardless of the presence of KChIP1. The inhibition rate of Kv4 alone and the size of Kv4 / KChIP was not very different from the fatty acids. Blocking of the Kv4 current magnitude by statistically significant 10 μM linoleicidic acid was observed in the presence of KChIP1 when its value was compared to each control, but not in the absence of KChIP1. However, there were significant differences when compared with Kv4.3 and Kv4.3 / KChIP KChIP1.
[534] In the absence of KChIP1, none of the fatty acids tested showed a statistically significant effect on the Kv4.3 inactivation period constant (FIG. 66B). Regardless of KChIP (γ-linolenic acid, ETI, ETY, and arachidonic acid), only fatty acids causing substantial current blocking reduced the Kv4.3 inactivation time constant when expressed with KChIP1. Linoleic acid showing only moderate KChIP-dependent Kv4.3 current blocking did not affect the Kv4.3 inactivation time constant (FIG. 66B). Thus, certain long chain fatty acids can mimic arachidonic acid to regulate Kv4 current kinetics in KChIP-dependent form. In general, there is a good link in the ability of certain fatty acids to block peak size and modify the kinetics of Kv4 / KChIP currents.
[535] Arachidonic acid does not disrupt the binding of Kv4 and KChIP
[536] The following assay was used for the experiment.
[537] In vitro binding assay
[538] The N-terminal domain of rat Kv4.3 was expressed as a GST fusion (GST-Kv4.3N) and purified from E. coli according to a protocol provided basically from Amersham Pharmacia Biotech (Pittsburgh, NJ). After recombinant rat KChIP1 protein was first expressed and purified as a GST-fusion, GST residues were cleaved using PreScisson Protiase (Amersham Pharmacia Biotech) to generate free KCHIP1 protein. Both GST-Kv4.3N and KChIP proteins were determined to be greater than 95% by Coomassie staining of denatured gels. In vitro binding assays were performed using Biacore 3000 (Biacore AB) (Uppsala, Sweden). Experiments were performed in phosphate buffer (PBS), pH 7.4, containing 1 mM CaCl ₂ and 0.05% polysorbate P-20. Anti-GST antibody (Biacore AB) was coupled to three flowcells of CM-5 chips at the level of 2000 resonance units (RU) using amine coupling. The final flow cell was activated and blocked with ethanolamine to serve as the reference control surface. GST-Kv4.3N terminal domains were captured on two anti-GST flowcells and GST alone was bound to the third anti-GST flowcell at a level of 150RU. Purified KChIP1 was then injected into all four flow cells in the presence and absence of 10 μM arachidonic acid. In addition, arachidonic acid (10 μM) was injected alone. Data is presented as GST reference-subtracted sensogram.
[539] Yeast 2-Hybrid Cell Lines and Proliferation Assays
[540] Diploid cell lines containing baits (N-terminal domain of Kv4.3 or empty vector pGBT9) and fish (KChIP1) plasmids were obtained as described in An, et al., 2000. For synchronization, non-selective SC-WL in the presence or absence of 5 ml or 10 μM ETYA of TrpLeuHis-free synthetic complete medium (SC-WLH) that screens for interaction-dependent proliferation after propagating the cell line in saturation 5 ml of medium was inoculated with the same OD 600. 5 mM 3-AT (3-amino-1, 2,4-triazole) was included in the medium to inhibit weak self-activating activity from Kv4.3 N-terminal domain baits. Cultures were grown at 30 ° C. for 17 hours and had an OD of 600 with a spectrophotometer.
[541] To test the assumption that arachidonic acid works by disrupting the binding between Kv4 and KChIP, first use surface plasmon resonance measurements (biosensors) to bind and degrade Kv4-KChIP interactions in the presence and absence of arachidonic acid. The steps were monitored. The intracellular N-terminal domain of Kv4.3 was expressed with GST fusion protein (GST-Kv4.3N) and fixed to the surface of the biosensor chip. Recombinant KChIP1 protein was passed through the chip surface in the presence and absence of 10 μM arachidonic acid. As shown in FIG. 67A, KChIP1 protein was bound to the GST-Kv4.3N surface, but no qualitative difference was observed on- and off-phase of KChIP1 and Kv4.3 N-terminal domains. Biosensor results were further confirmed in yeast two-hybrid systems where Kv4-KChIP interaction-dependent proliferation in selective SC-WLH media was not affected by 10 μM ETYA (FIG. 67B). ETYA was used in this experiment instead of arachidonic acid, since both ETYA and arachidonic acid affect nearly equally Kv4 current, while ETYA is not metabolizable and therefore not suitable for the experiment. Taken together, the results show that the fatty acids tested do not disrupt the bond between Kv4 and KChIP.
[542] Kv4 / KChIP is more sensitive to AA regulation than Kv1.1 / Kvβ1
[543] Pore-forming alpha subunits of ion channels, including the pore-forming alpha subunits of potassium channels, often do not function alone. They bind with auxiliary subunits, and these auxiliary subunits can significantly change panel activity. Thus, it is more useful to study alpha subunits in combination with their auxiliary subunits as physiologically suitable channels are complexes of alpha-adjuvant subunits.
[544] When expressed alone, recombinant Kv4 alpha subunits have been shown to be much more sensitive to AA inhibition than alpha subunits of potassium channels opened by some other voltages (eg Kv1.1) (Villarroel, 1996, As above). However, the paper studied AA regulation of the alpha subunit of the channel only. When all channels were tested in the presence of their cognate auxiliary subunits, it was not known whether Kv4 current would be more sensitive to AA regulation than other channel currents.
[545] In this example, the above was tested by measuring two alpha / adjuvant complexes: Kv4.3 / KChIP1 and Kv1.1 / Kvβ1 (Kvβ1 is one of the traditional potassium channel beta subunits and significantly alters the Kv1.1 kinetics. Change). Kv4.3 / KChIP1 and Kv1.1 / Kvβ1 were expressed in Xenopus oocytes, respectively, and the current generated thereby was recorded in the presence or absence of 10 μM AA. While the peak magnitude of Kv1.1 / kvβ1 current did not increase much (10 ± 4 to 14 ± 1 μA) at 10 μM AA, the peak size of Kv4.3 / KChIP1 was significantly increased (44 ± 10 to 21 ± 1 μA). , Table 4) means. Kinematically, KvKv4.3 / KChIP1 was more sensitive to AA regulation than Kv1.1 / Kvβ1 (Table 4). Whereas 10 μM AA did not cause a statistically significant decrease in the inactivation time constant of Kv1.1 / Kvβ1 (11 ± 1 to 9 ± 1 ms), the same concentration of AA resulted in the inactivation time constant of Kv4.3 / KChIP1 (104 ± 7 to 55 ± 4 ms). The results indicate that AA readily regulates both the kinetics and size of Kv4 / KChIP of native neurons more easily than the kinetics and size of Kv1.1 / Kvβ1.
[546] AA Regulation of Kv4, Kv4 / KChIP1, Kv1.1, and Kv1.1 / Kvβ1 Currents in Xenopus OocytesKv4.3 Kv4.3 KV4.3 / KChIP1 KV4.3 / KChIP1 Kv1.1 Kv1.1 Kv1.1 / Kvβ1 Kv1.1 / Kvβ1 0 μM AA 10 μM AA 0 μM AA 10 μM AA 10 μM AA 10 μM AA 0 μM AA 10 μM AA Inactivity time constant (ms ± SEM) 75 ± 7 66 ± 6 104 ± 7 55 ± 4 N.A. N.A. 11 ± 1 9 ± 1 Peak size (μA ± SEM) 30 ± 7 13 ± 1 44 ± 10 21 ± 4 19 ± 2 21 ± 3 11 ± 4 14 ± 1
[547] Example 26 K-Channel Interacting Protein-2 (KChIP2), Splice Variants, Chromosome Structuring and Localization
[548] In this example, variants of KChIP2 and their chromosomal structuring were identified using standard techniques. KChIP2 gene is highly conserved at the amino acid level between human, rat, and mouse. Multiple human splice variants were identified by database mining and cDNA library screening. Selective splicing yields variable length N-terminal domains, but the core C-terminal domain is sufficient to bind and regulate Kv4. The human KChIP2 gene is about 18 kb in the q23 region of the human chromosome between WI-8488 and WI-6750. This region is syntenic on mouse chromosome 19 between D19Mit40 and D19Mit11. Rat variants found by database mining changed the last 5 amino acids and retained the ability to bind and regulate Kv4. Thus, these multiple variants of KChIP2 appear to function similarly to Kv4 regulation.
[549] Example 27: KChIP1L Function and Expression
[550] RT-PCR was performed to examine tissue expression of rat KChIP11 (KChIP1 length) splice variants. PolyA + RNA from heart, brain, lung, spleen, liver, skeletal muscle, kidney and testes was purchased from Clontech. PCR conditions were modified (50 ° C. for 1 hour; 94 ° C. for 3 minutes; 50 cycles at 94 ° C. for 30 seconds; 65 ° C. for 30 seconds; and 68 ° C. for 2 minutes) 5 ′ primer GGTACCTTCTCGTCCCTGCAGACCAAACAAAG (SEQ ID NO: 104 ) And 3 'primer CGGTAAAGGACTTGCAGTTCTCTC (SEQ ID NO: 105) were amplified and RT-PCR was used using Clonetech's one-step RT-PCR kit. The 5 'primer is KChIP1-specific. Both KChIP1 and KChIP11 can be amplified by the same primer set, which results in two different PCR products that are divided into two bands by electrophoresis. KChIP11-specific bands are found only in the brain, which means that they are specifically expressed in the brain. The same response also showed a strong KChIP-1 specific signal in the case of the brain and a band almost invisible in skeletal muscle. No KChIP1 or KChIP11 signals were observed in any other tissues examined. In summary, KChIP11 expression was brain-specific whereas KChIP1 expression was expressed at very low levels in skeletal muscle and predominantly in the brain.
[551] The function of KChIP11 was also tested in Xenopus oocytes. Kv4.3 cRNA was injected into xenopus oocytes in the presence or absence of KChIP11 cDNA. Similar to KChIP1, KChIP11 increased the peak size of Kv4.3 from 15 ± 4μA to 55 ± 7μA and increased the inactivation time constant from 56 ± 40ms to 100 ± 8ms (Table 5). The data demonstrated in vitro that KChIP11, like KChIP1, regulates the peak magnitude and kinetics of Kv4 current.
[552] Considering that 185 C-terminal amino acids common to both KChIP1 and KChIP11 are responsible for binding to Kv4.3, KChIP11 appears to bind with Kv4 in the brain. Insertion of additional amino acids of the KChIP11 protein may be important for unknown function, and the DNA sequence encoding this amino acid may be used as a genetic marker specific for detecting cell tissue and / or cell type specific expression of the specific splice variant. Can be.
[553] DNA and protein sequences specific for KChI11 splice variants are identical in rats and humans. Thus, functional data obtained with KChIP11 molecules from one species also applies to those obtained from other species.
[554] Regulation of Kv4.3 by KChIP11 and KChIP1N Kv4.3 coexpressed with right side Kv4.3 expression alone KChIP11 KChIP1 KChIP1N Inactivity time constant (ms ± SEM) 56 ± 4 100 ± 8 112 ± 3 1778 ± 136 Peak magnitude (μA ± SEM) 15 ± 4 55 ± 7 59 ± 5 18 ± 3
[555] Example 28 KChIP1N Function and Expression
[556] The expression of rat KChIP1N was examined by Taqman technique using probe GGCAAAGAAGCGCGATTTT (SEQ ID NO: 106), forward primer TCCCGGGTAGGCAAGCA (SEQ ID NO: 107) and reverse primer CCTGCTCAAGCCCAGCACTGCA (SEQ ID NO: 108). Probes are specific for KChIP1N. As shown in FIG. 68, KChIP1N was predominantly expressed in the dorsal root ganglion (DRG) and at low levels in the spinal cord and brain.
[557] The function of KChIP1N in Xenopus oocytes was also examined. Kv4.3 cRNA was injected into Xenopus oocytes in the presence or absence of KChIP1N cRNA. Compared with KChIP1 and KChIP11, KChIP1N did not affect the peak size of Kv4.3 (15 ± 4 vs 18 ± 3 with and without KChIP1N, Table 5). Surprisingly, KChIP1N resulted in an increase in the inactivation time constant of Kv4.3, which is much greater than KChIP1 or KChIP11 (32-fold increase by KChIP1N vs. 2-fold increase by KChIP1 or KChIP11; Table 5).
[558] The above data demonstrated that KChIPN regulates Kv4 current in vitro in a manner different from KChIP1N or KChIP11. First, the increase of KChIP1N inactivation time constant was significantly greater as opposed to the increase mediated by KChIP1 or KChIP11. As a result, KChIP1N could change the Kv4.3 current, which quickly deactivates during 500ms sec +40 volt pulses, to almost inactive. Second, KChIP1N did not affect Kv4 peak size at the particular concentration tested. Since all KChIP1 splice variants share a C-terminal 196 amino acid, the data indicate an important and distinct function of the N-terminal domain of KChIP1N, a unique 36 amino acid.
[559] Example 29 KChIP2 Splice Variant Function
[560] In this example, the functions of KChIP2 splice variants, rat KChIP21, human KChIP2 and rat KChIP2C of Xenopus oocytes were investigated. The results obtained from the above experiments are summarized in the table below.
[561] Regulation of KV4 by KChIP2 Splice Variants Kv4.3 co-expressed with right KChIP21 KChIP2m KChIP2 KChIP2C Single expression Peak magnitude (μA ± SEM) 51 ± 4 40 ± 4 44 ± 3 44 ± 3 14 ± 3 Inactivity time constant (ms ± SEM) 87 ± 4 70 ± 2 90 ± 3 74 ± 4 55 ± 4
[562] The data demonstrated that the KChIP2 splice variant regulates Kv4 currents similar to KChIP2m (Table 6). Since there is a very high homology (> 95%) of the amino acid levels between rat and human KChIP2, the results obtained using KChIP2 molecules from one species will be similar to KChIP2 molecules from other species.
[563] Example 30 KChIP4 Function and Expression
[564] Northern analysis was performed to measure tissue expression of KChIP4. Rat Clonetech MTN Northern blots were probed using probes taken from the 3′UT region of rat KChIP4 (568-909), common to both N-terminal splice variants of KChIP4. A predominant band of about 2.4 kb was found only in the brain in the tissues shown in the Northern blot (heart, brain, lung, spleen, liver, muscle, kidney and testes). Faint bands were present in the kidneys with rather fast motility. Thus, the N-terminal splice variant of KChIP4 was predominantly expressed in the brain and at low levels in the kidney.
[565] The ability of KChIP4 to bind Kv4 was also examined using the yeast two hybrid assay. The H domain of KChIP4, which is common to all N-terminal splice variants of KChIP4 and homologous to other KChIPs, is expressed as "fish" using standard techniques, and Kv4.3. The N-terminal domain of Kv4.2 was expressed as "bait (Kv4.3N, Kv4.2N, respectively)." KChIP4H binds Kv4.3N and Kv4.2N in both proliferation assays and β-galactosidase assays. But failed to combine with Kv1.1N or other control baits. The result means that KChIP4 binds to the Kv4 channel in a particular form.
[566] Example 31 Functional Analysis of KChIP4N2
[567] Unlike KChIP1, KChIP2 and KChIP3, KChIP4N2 showed a dose-dependent tjd effect on the peak size of Kv4.3 when they were co-administered with xenopus oocytes (Table 7). At higher concentrations (e.g., 5-fold dilution of the stock solution), KChIP4N2 suppresses Kv4.3 current magnitude, while a more diluted concentration of KChIP4N2 augments or shows no effect on Kv4 current magnitude. (Table 7).
[568] Unlike KChIP1, KChIP2 and KChIP3, KChIP4N2 showed a dose-dependent effect on the inactivation kinetics of Kv4.3 when they were injected together into xenopus oocytes (Table 7). At high concentrations, KChIP4 converts the rapidly deactivating Kv4.3 current into a rarely deactivated current (e.g. at 5 times dilution of the stock solution, the current curve is too slow to decrease over time to fix the deactivation time constant). Could not be obtained). When more diluted KChIP4N2 cRNA was injected, the inactivation time constant gradually decreased to the value obtained in the absence of KChIP4N2.
[569] Control of Peak Size and Kinetics of Kv4.3 Current by Different Concentrations of KChIP4N2 in Xenopus Oocytes Kv4.3 coexpressed with KChIP4N2 diluted by the right number (1 × = stock solution) 1 × 5 × 30 × 120 × 500 × none Inactivity time constant (ms ± SEM)681 ± 28 193 ± 13 84 ± 5 56 ± 4 Peak magnitude (μA ± SEM) 0 ± 0 4 ± 1 25 ± 2 16 ± 3 9 ± 4 15 ± 4
[570] The N-terminal domain of KChIP4N2 is required for the observed action of KChIP4N2. Deletion of the N-terminal domain essentially eliminated the effect on the peak size of wild-type KChIP4N2 and the inactivation time constant of Kv4.3 (Table 8).
[571] The action of the N-terminal domain of KChIP4N2 appears to be dominant over other KChIP molecules. We produced a chimeric molecule, 4N-1H, wherein the N-terminal domain of KChIP4N2 was fused to the C-terminal H domain of 185 amino acids of KChIP1 (KChIP1H has homology with other KCHIPs). When KChIP1H was expressed with Kv4, 4N-1H regulated Kv4 current almost identically to KChIP1H and produced a significantly different regulatory profile than that produced by KChIP4N2 (An F. et al. 2000, Nature 403: 553-556). However, when 4N-1H was expressed with Kv4.3, it produced a regulatory profile that was hardly distinguished from the regulatory profile of KChIP4N2 in place of the regulatory profile of KChIP1H or KChIP1 (Table 6). It is possible that the N-terminal domain of KChIP4N2 could act as a module, and its regulatory effect was superior to that of other KChIPs.
[572] The N-terminal domain of KChIP4N2 is necessary for the effect of KChIP4N2 and is superior to KChIP1 Kv4.3 co-expressed with the one on the right KChIP4 (30 × dilution rate) KChIP4H 4N-1H Inactivity time constant (ms ± SEM) 681 ± 28 105 ± 4 680 ± 39 Peak magnitude (μA ± SEM) 25 ± 2 19 ± 2 26 ± 3
[573] Since KChIP4 and other KChIP bind to Kv4 N-terminal domain (Kv4N), it can be seen that KChIP binds at the same position on Kv4N. In this case, KChIP4N2 and KChIP1 must compete with each other to regulate Kv4 current, when both of them combine with Kv4. This hypothesis was tested and as shown in FIG. 61, KChIP4N2 and KChIP1 actually competed with each other to regulate Kv4 current. Since the concentration of KChIP4 cRNA injected into Xenopus oocytes remained constant, while the concentration of KChIP4 cRNA gradually increased, the Kv4.3 current profile changed from that of KChIP4 cRNA to something similar to KChIP1. Mutually, the concentration of KChIP1 cRNA remained constant while the concentration of KChIP4 cDNA gradually increased, so the current profile changed from KChIP1's current profile to something similar to KChIP4.
[574] The results indicate that KChIP1 and KChIP4 compete with each other functionally by competitively combining with the same position on Kv4.3N. The results also resulted in a current in which different combinations of KChIP4N2 and other KChIPs had qualitatively quantitatively similar or different hybrid profiles to the parental profile. It can be imagined that KChIP4N2 and other KChIPs are co-expressed in certain cell types in vivo (eg brain). Thus, depending on the concentration in vivo in certain cell types, KChIP4N2 and other KChIPs can generate quite different currents even through the pore-forming alpha subunit being the same Kv4 molecule.
[575] There are many aspects to the relationship of the observations expected for KChIP4N2. The data means that the N-terminal domain has a predominant regulatory function that can be separated from the function of the H domain (which binds to Kv4 and regulates the Kv4 current magnitude and kinetics described in An et al. As a result, it can be seen that the N-terminal domain of KChIP4N2 interacts with some of the potassium channels in addition to the N-terminal domain of Kv4. Given the significant effect of KChIP4N2 on inactivation kinetics, this different location on Kv4 appears to be important for controlling the transport of potassium ions through the channel. It is possible to use the N-terminal domain of KChIP4N2 as a tool for designing and performing protein / peptide / compound screens using this unique activity as translated information. It is possible to use these screening assays to obtain proteins / peptides / compounds that modulate Kv4 activity in KChIP dependent or independent format.
[576] As discussed above, KChIP1N and KChIP4N2 share similar Kv4 current regulation characteristics. Both can convert a quickly deactivated Kv4 current into a rarely deactivated current. Both do not affect the peak size of Kv4. Interestingly, when the N-terminal domains of human KChIP1N and monkey KChIP4N2 are listed (using Megalign, DNA Star), they show considerable homology (Figure 1), suggesting the presence of protein motifs that predict unique regulation by KChIP1N and KChIP4N2 62). In contrast, the N-terminal domains of human / rat KChIP1 and monkey KChIP4N2 were quite different (FIG. 62).
[577] Example 32 Functional Analysis of KChIP4N1 and KChIP4N3
[578] KChIP4N1 and KChIP4N3 were injected into Xenopus oocytes along with Kv4.3 cRNA. The regulatory effects of different proteins on Kv4.3 are summarized in Table 9. Both increased the inactivation time constant of Kv4.3. While KChIP4N3 increased the peak size of Kv4.3, KChIP4N1 showed a statistically significant effect on Kv4.3 size.
[579] Regulation of Kv4 by KChIP4N1 and KChIP4N3 in Xenopus Oocytes Kv4.3 coexpressed with right side KChIP4N1 KChIP4N3 Single expression Peak magnitude (μA ± SEM) 6 ± 1 (ns) 43 ± 4 15 ± 4 Inactivity time constant (ms ± SEM) 112 ± 7 85 ± 4 56 ± 4
[580] Equivalent
[581] Those skilled in the art will recognize or ascertain many equivalents to the specific aspects of the invention described herein by using routine experimentation only. It is intended that such equivalents be included in the following claims.

权利要求:
Claims (53)
[1" claim-type="Currently amended] a) SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 5, SEQ ID NO: 7, SEQ ID NO: 9, SEQ ID NO: 11, SEQ ID NO: 13, SEQ ID NO: 15, SEQ ID NO: 17, SEQ ID NO: 19, SEQ ID NO: 21, SEQ ID NO: 23, SEQ ID NO: 25, SEQ ID NO: 27, SEQ ID NO: 29, SEQ ID NO: 31, SEQ ID NO: 33, SEQ ID NO: 35, SEQ ID NO: 37, SEQ ID NO: 39, SEQ ID NO: 48, SEQ ID NO: 50, SEQ ID NO: 52, SEQ ID NO: 54, SEQ ID NO: 56, SEQ ID NO: 58, SEQ ID NO: 69, SEQ ID NO: 71, SEQ ID NO: 74, SEQ ID NO: 75, SEQ ID NO: 77, SEQ ID NO: 79, SEQ ID NO: 80, SEQ ID NO: 82, SEQ ID NO: 84, SEQ ID NO: 86, SEQ ID NO: 88, SEQ ID NO: 90, SEQ ID NO: 92, SEQ ID NO: 94, SEQ ID NO: 96, SEQ ID Nucleotide sequence of NO: 98, SEQ ID NO: 100, or SEQ ID NO: 102, Accession No. 98936, 98937, 98938, 98939, 98940, 98941, 98942, 98943, 98944, 98945, 98946, 98947, 98948, 98949, 98950, 98951, 98991, 98993, 98994 or PTA- DNA insert of plasmid deposited in ATCC as 316 Sequence, or a nucleic acid molecule comprising a complementary sequence thereof with the same nucleotide sequence at least 60%;
b) SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 5, SEQ ID NO: 7, SEQ ID NO: 9, SEQ ID NO: 11, SEQ ID NO: 13, SEQ ID NO: 15, SEQ ID NO: 17, SEQ ID NO: 19, SEQ ID NO: 21, SEQ ID NO: 23, SEQ ID NO: 25, SEQ ID NO: 27, SEQ ID NO: 29, SEQ ID NO: 31, SEQ ID NO: 33, SEQ ID NO: 35, SEQ ID NO: 37, SEQ ID NO: 39, SEQ ID NO: 48, SEQ IDNO: 50, SEQ ID NO: 52, SEQ ID NO: 54, SEQ ID NO: 56 , SEQ ID NO: 58, SEQ ID NO: 69, SEQ ID NO: 71, SEQ ID NO: 74, SEQ ID NO: 75, SEQ ID NO: 77, SEQ ID NO: 79, SEQ ID NO: 80, SEQ ID NO: 82, SEQ ID NO: 84, SEQ ID NO: 86, SEQ ID NO: 88, SEQ ID NO: 90, SEQ ID NO: 92, SEQ ID NO: 94, SEQ ID NO: 96, SEQ ID NO : 98, the nucleotide sequence of SEQ ID NO: 100, or SEQ ID NO: 102, Accession Nos. 98936, 98937, 98938, 98939, 98940, 98941, 98942, No. 98943, 98944, 98945, 98946, 98947, 98948, 98949, 98950, 98951, 98991, 98993, 98994 or PTA-316 DNA insertion of plasmid deposited in ATCC as Nucleic acid molecule comprising a sequence, or a fragment of at least 583 of the nucleic acid material containing a nucleotide sequence complementary thereof;
c) SEQ ID NO: 2, SEQ ID NO: 4, SEQ ID NO: 6, SEQ ID NO: 8, SEQ ID NO: 10, SEQ ID NO: 12, SEQ ID NO: 14, SEQ ID NO: 16, SEQ ID NO: 18, SEQ ID NO: 20, SEQ ID NO: 22, SEQ ID NO: 24, SEQ ID NO: 26, SEQ ID NO: 28, SEQ ID NO: 30, SEQ ID NO: 32, SEQ ID NO: 34, SEQ ID NO: 36, SEQ ID NO: 38, SEQ ID NO: 40, SEQ ID NO: 49, SEQ ID NO: 51, SEQ ID NO: 53, SEQ ID NO: 55, SEQ ID NO: 57, SEQ ID NO: 59, SEQ ID NO: 70, SEQ ID NO: 72, SEQ ID NO: 76, SEQ ID NO: 78, SEQ ID NO: 81, SEQ ID NO: 83, SEQ ID NO: 85, SEQ ID NO: 87, SEQ ID NO: 89, SEQ ID NO: 91, SEQ ID NO: 93, SEQ ID NO: 95, SEQ ID NO: 97, SEQ ID NO: 99, SEQ ID NO: 101, SEQ ID NO: 103, or amino acid sequence of SEQ ID NO: 109 or Accession Nos. 98936, 98937, 98938, 98939, 98940, 98941, 98942, 98943, 98944 Deposited with the ATCC as No. 98945, 98946, 98947, 98948, 98949, 98950, 98951, 98991, 98993, 98994 or PTA-316. In the DNA insertion sequence of the plasmid To an amino acid sequence with about 60% or more nucleic acid molecules encoding a polypeptide comprising an amino acid sequence encoded;
d) SEQ ID NO: 2, SEQ ID NO: 4, SEQ ID NO: 6, SEQ ID NO: 8, SEQ ID NO: 10, SEQ ID NO: 12, SEQ ID NO: 14, SEQ ID NO: 16, SEQ ID NO: 18, SEQ ID NO: 20, SEQ ID NO: 22, SEQ ID NO: 24, SEQ ID NO: 26, SEQ ID NO: 28, SEQ ID NO: 30, SEQ ID NO: 32, SEQ ID NO: 34, SEQ ID NO: 36, SEQ ID NO: 38, SEQ ID NO: 40, SEQ ID NO: 49, SEQ ID NO: 51, SEQ ID NO: 53, SEQ ID NO: 55, SEQ ID NO: 57, SEQ ID NO: 59, SEQ ID NO: 70, SEQ ID NO: 72, SEQ ID NO: 76, SEQ ID NO: 78, SEQ ID NO: 81, SEQ ID NO: 83, SEQ ID NO: 85, SEQ ID NO: 87, SEQ ID NO: 89, SEQ ID NO: 91, SEQ ID NO: 93, SEQ ID NO: 95, SEQ ID NO: 97, SEQ ID NO: 99, SEQ ID NO: 101, SEQ ID NO: 103, or amino acid sequence of SEQ ID NO: 109 or Accession Nos. 98936, 98937, 98938, 98939, 98940, 98941, 98942, 98943, 98944 Deposited with the ATCC as No. 98945, 98946, 98947, 98948, 98949, 98950, 98951, 98991, 98993, 98994 or PTA-316. In the DNA insertion sequence of the plasmid A nucleic acid molecule encoding a fragment of a polypeptide comprising an amino acid sequence encoded by wherein the fragment is SEQ ID NO: 2, SEQ ID NO: 4, SEQ ID NO: 6, SEQ ID NO: 8, SEQ ID NO: 10 , SEQ ID NO: 12, SEQ ID NO: 14, SEQ ID NO: 16, SEQ ID NO: 18, SEQ ID NO: 20, SEQ ID NO: 22, SEQ ID NO: 24, SEQ ID NO: 26, SEQ ID NO: 28, SEQ ID NO: 30, SEQ ID NO: 32, SEQ ID NO: 34, SEQ ID NO: 36, SEQ ID NO: 38, SEQ ID NO: 40, SEQ ID NO: 49, SEQ ID NO : 51, SEQ ID NO: 53, SEQ ID NO: 55, SEQ ID NO: 57, SEQ ID NO: 59, SEQ ID NO: 70, SEQ ID NO: 72, SEQ ID NO: 76, SEQ ID NO: 78 , SEQ ID NO: 81, SEQ ID NO: 83, SEQ ID NO: 85, SEQ ID NO: 87, SEQ ID NO: 89, SEQ ID NO: 91, SEQ ID NO: 93, SEQ ID NO: 95, SEQ Amino acid sequence of SEQ ID NO: 97, SEQ ID NO: 99, SEQ ID NO: 101, SEQ ID NO: 103, or SEQ ID NO: 109 or Accession Nos. 98936, 98937, 98938, 98939 , 98940, 98941, 98942, 98943, 98944, 98945, 98946, 98947, 98948, 98949, 98950, 98951, 98991, 98993, 98994 or PTA-316 comprising at least 15 contiguous amino acid residues of the amino acid sequence encoded by the DNA insertion of the plasmid deposited with the ATCC; And
e) SEQ ID NO: 2, SEQ ID NO: 4, SEQ ID NO: 6, SEQ ID NO: 8, SEQ ID NO: 10, SEQ ID NO: 12, SEQ ID NO: 14, SEQ ID NO: 16, SEQ ID NO: 18, SEQ ID NO: 20, SEQ ID NO: 22, SEQ ID NO: 24, SEQ ID NO: 26, SEQ ID NO: 28, SEQ ID NO: 30, SEQ ID NO: 32, SEQ ID NO: 34, SEQ ID NO: 36, SEQ ID NO: 38, SEQ ID NO: 40, SEQ ID NO: 49, SEQ ID NO: 51, SEQ ID NO: 53, SEQ ID NO: 55, SEQ ID NO: 57, SEQ ID NO: 59, SEQ ID NO: 70, SEQ ID NO: 72, SEQ ID NO: 76, SEQ ID NO: 78, SEQ ID NO: 81, SEQ ID NO: 83, SEQ ID NO: 85, SEQ ID NO: 87, SEQ ID NO: 89, SEQ ID NO: 91, SEQ ID NO: 93, SEQ ID NO: 95, SEQ ID NO: 97, SEQ ID NO: 99, SEQ ID NO: 101, SEQ ID NO: 103, or amino acid sequence of SEQ ID NO: 109, or Accession Nos. 98936, 98937, 98938, 98939, 98940, 98941, 98942, 98943, 9 Deposited to ATCC as 98944, 98945, 98946, 98947, 98948, 98949, 98950, 98951, 98991, 98993, 98994 or PTA-316. DNA sequence of the prepared plasmid Nucleic acid molecules encoding natural allelic variants of polypeptides comprising an amino acid sequence encoded by wherein nucleic acid molecules are subjected to stringent conditions under SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 5, SEQ ID NO: 7, SEQ ID NO: 9, SEQ ID NO: 11, SEQ ID NO: 13, SEQ ID NO: 15, SEQ ID NO: 17, SEQ ID NO: 19, SEQ ID NO: 21, SEQ ID NO: 23, SEQ ID NO: 25, SEQ ID NO: 27, SEQ ID NO: 29, SEQ ID NO: 31, SEQ ID NO: 33, SEQ ID NO: 35, SEQ ID NO: 37, SEQ ID NO: 39, SEQ ID NO: 48, SEQ ID NO: 50, SEQ ID NO: 52, SEQ ID NO: 54, SEQ ID NO: 56, SEQ ID NO: 58, SEQ ID NO: 69, SEQ ID NO: 71, SEQ ID NO: 74, SEQ ID NO: 75, SEQ ID NO: 77, SEQ ID NO: 79, SEQ ID NO: 80, SEQ ID NO: 82, SEQ ID NO: 84, SEQ ID NO: 86, SEQ ID NO: 88, SEQ ID NO: 90, SEQ ID NO: 92, SEQ ID NO: 94, SEQ ID NO: 96, SEQ ID NO: 98, SEQ ID NO: 100, or SEQ ID NO: 102, or Accession No. 98936, 98937, 98938, 98939, 98940, 98941, 98942, 98943, 98944, 98945, 98946, 98947 , 98948, 98949, 98950, 98951, 98991, 98993, 98994 or PTA-316 as hybridization to nucleic acid molecules comprising DNA insert sequences of plasmids deposited in the ATCC. Isolated nucleic acid molecule selected from the group consisting of:
[2" claim-type="Currently amended] The method of claim 1,
a) SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 5, SEQ ID NO: 7, SEQ ID NO: 9, SEQ ID NO: 11, SEQ ID NO: 13, SEQ ID NO: 15, SEQ ID NO: 17, SEQ ID NO: 19, SEQ ID NO: 21, SEQ ID NO: 23, SEQ ID NO: 25, SEQ ID NO: 27, SEQ ID NO: 29, SEQ ID NO: 31, SEQ ID NO: 33, SEQ ID NO: 35, SEQ ID NO: 37, SEQ ID NO: 39, SEQ ID NO: 48, SEQ ID NO: 50, SEQ ID NO: 52, SEQ ID NO: 54, SEQ ID NO: 56, SEQ ID NO: 58, SEQ ID NO: 69, SEQ ID NO: 71, SEQ ID NO: 74, SEQ ID NO: 75, SEQ ID NO: 77, SEQ ID NO: 79, SEQ ID NO: 80, SEQ ID NO: 82, SEQ ID NO: 84, SEQ ID NO: 86, SEQ ID NO: 88, SEQ ID NO: 90, SEQ ID NO: 92, SEQ ID NO: 94, SEQ ID NO: 96, SEQ ID NO: 98, SEQ ID NO: 100, or the nucleotide sequence of SEQ ID NO: 102, or Accession Nos. 98936, 98937, 98938, 98939, 98940, 98941, 98942 , 98943, 98944, 98945, 98946, 98947, 98948, 98949, 98950, 98951, 98991, 98993, 98994 or PTA D of the plasmid deposited in ATCC as -316 Nucleic acid molecules comprising NA insertion sequences, or complementary sequences thereof; And
b) SEQ ID NO: 2, SEQ ID NO: 4, SEQ ID NO: 6, SEQ ID NO: 8, SEQ ID NO: 10, SEQ ID NO: 12, SEQ ID NO: 14, SEQ ID NO: 16, SEQ ID NO: 18, SEQ ID NO: 20, SEQ ID NO: 22, SEQ ID NO: 24, SEQ ID NO: 26, SEQ ID NO: 28, SEQ ID NO: 30, SEQ ID NO: 32, SEQ ID NO: 34, SEQ ID NO: 36, SEQ ID NO: 38, SEQ ID NO: 40, SEQ ID NO: 49, SEQ ID NO: 51, SEQ ID NO: 53, SEQ ID NO: 55, SEQ ID NO: 57, SEQ ID NO: 59, SEQ ID NO: 70, SEQ ID NO: 72, SEQ ID NO: 76, SEQ ID NO: 78, SEQ ID NO: 81, SEQ ID NO: 83, SEQ IDNO: 85, SEQ ID NO: 87, SEQ ID NO: 89, SEQ ID NO: 91, SEQ ID NO: 93, SEQ ID NO: 95, SEQ ID NO: 97, SEQ ID NO: 99, SEQ ID NO: 101, SEQ ID NO : 103, or amino acid sequence of SEQ ID NO: 109 or Accession Nos. 98936, 98937, 98938, 98939, 98940, 98941, 98942, 98943, 98944 Plasmid deposited with ATCC as 9898, 98946, 98947, 98948, 98949, 98950, 98951, 98991, 98993, 98994 or PTA-316. In the DNA insertion sequence To an isolated nucleic acid molecule as claimed selected from the group consisting of a polypeptide comprising an amino acid sequence encoded by a nucleic acid molecule encoding.
[3" claim-type="Currently amended] The nucleic acid molecule of claim 1, further comprising a vector nucleic acid sequence.
[4" claim-type="Currently amended] The nucleic acid molecule of claim 1, further comprising a nucleic acid sequence encoding a heterologous polypeptide.
[5" claim-type="Currently amended] A host cell containing the nucleic acid molecule of claim 1.
[6" claim-type="Currently amended] 6. The host cell of claim 5, wherein the host cell is a mammalian host cell.
[7" claim-type="Currently amended] A mammalian host cell other than a human containing the nucleic acid molecule of claim 1.
[8" claim-type="Currently amended] a) SEQ ID NO: 2, SEQ ID NO: 4, SEQ ID NO: 6, SEQ ID NO: 8, SEQ ID NO: 10, SEQ ID NO: 12, SEQ ID NO: 14, SEQ ID NO: 16, SEQ ID NO: 18, SEQ ID NO: 20, SEQ ID NO: 22, SEQ ID NO: 24, SEQ ID NO: 26, SEQ ID NO: 28, SEQ ID NO: 30, SEQ ID NO: 32, SEQ ID NO: 34, SEQ ID NO: 36, SEQ ID NO: 38, SEQ ID NO: 40, SEQ ID NO: 49, SEQ ID NO: 51, SEQ ID NO: 53, SEQ ID NO: 55, SEQ ID NO: 57, SEQ ID NO: 59, SEQ ID NO: 70, SEQ ID NO: 72, SEQ ID NO: 76, SEQ ID NO: 78, SEQ ID NO: 81, SEQ ID NO: 83, SEQ ID NO: 85, SEQ ID NO: 87, SEQ ID NO: 89, SEQ ID NO: 91, SEQ ID NO: 93, SEQ ID NO: 95, SEQ ID NO: 97, SEQ ID NO: 99, SEQ ID NO: 101, SEQ ID NO: 103, or amino acid sequence of SEQ ID NO: 109 or Accession Nos. 98936, 98937, 98938, 98939, 98940, 98941, 98942, 98943, 98944 Deposited with the ATCC as No. 98945, 98946, 98947, 98948, 98949, 98950, 98951, 98991, 98993, 98994 or PTA-316. In the DNA insertion sequence of the plasmid Fragment of a polypeptide comprising an amino acid sequence encoded by wherein fragment comprises SEQ ID NO: 2, SEQ ID NO: 4, SEQ ID NO: 6, SEQ ID NO: 8, SEQ ID NO: 10, SEQ ID NO: 12, SEQ ID NO: 14, SEQ ID NO: 16, SEQ ID NO: 18, SEQ ID NO: 20, SEQ ID NO: 22, SEQ ID NO: 24, SEQ ID NO: 26, SEQ ID NO: 28, SEQ ID NO: 30, SEQ ID NO: 32, SEQ ID NO: 34, SEQ ID NO: 36, SEQ ID NO: 38, SEQ ID NO: 40, SEQ ID NO: 49, SEQ ID NO: 51, SEQ ID NO: 53, SEQ ID NO: 55, SEQ ID NO: 57, SEQ ID NO: 59, SEQ ID NO: 70, SEQ ID NO: 72, SEQ ID NO: 76, SEQ ID NO: 78, SEQ ID NO: 81, SEQ ID NO: 83, SEQ ID NO: 85, SEQ ID NO: 87, SEQ ID NO: 89, SEQ ID NO: 91, SEQ ID NO: 93, SEQ ID NO: 95, SEQ ID NO: 97, SEQ Amino acid sequence of SEQ ID NO: 99, SEQ ID NO: 101, SEQ ID NO: 103, or SEQ ID NO: 109 or Accession Nos. 98936, 98937, 98938, 98939, 98940, 98941, 98942, 98943, 98944, 98945, 98946, 98947, 98948, 98949, 98950, 98951, 98991, 9899 3, 98994 or PTA-316 comprising at least 15 contiguous amino acids of an amino acid sequence encoded by the DNA insertion of a plasmid deposited with ATCC);
b) SEQ ID NO: 2, SEQ ID NO: 4, SEQ ID NO: 6, SEQ ID NO: 8, SEQ ID NO: 10, SEQ ID NO: 12, SEQ ID NO: 14, SEQ ID NO: 16, SEQ ID NO: 18, SEQ ID NO: 20, SEQ ID NO: 22, SEQ ID NO: 24, SEQ ID NO: 26, SEQ ID NO: 28, SEQ ID NO: 30, SEQ ID NO: 32, SEQ ID NO: 34, SEQ ID NO: 36, SEQ ID NO: 38, SEQ ID NO: 40, SEQ ID NO: 49, SEQ ID NO: 51, SEQ ID NO: 53, SEQ ID NO: 55, SEQ ID NO: 57, SEQ ID NO: 59, SEQ ID NO: 70, SEQ ID NO: 72, SEQ ID NO: 76, SEQ ID NO: 78, SEQ ID NO: 81, SEQ ID NO: 83, SEQ ID NO: 85, SEQ ID NO: 87, SEQ ID NO: 89, SEQ ID NO: 91, SEQ ID NO: 93, SEQ ID NO: 95, SEQ ID NO: 97, SEQ ID NO: 99, SEQ ID NO: 101, SEQ ID NO: 103, or amino acid sequence of SEQ ID NO: 109 or Accession Nos. 98936, 98937, 98938, 98939, 98940, 98941, 98942, 98943, 98944 Deposited with the ATCC as No. 98945, 98946, 98947, 98948, 98949, 98950, 98951, 98991, 98993, 98994 or PTA-316. DNA insertion sequence of the plasmid Natural allelic variants of the polypeptide comprising the encoded amino acid sequence, wherein the polypeptide is subjected to stringent conditions under SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 5, SEQ ID NO: 7, SEQ ID NO : 9, SEQ ID NO: 11, SEQ ID NO: 13, SEQ ID NO: 15, SEQ ID NO: 17, SEQ ID NO: 19, SEQ ID NO: 21, SEQ ID NO: 23, SEQ ID NO: 25 , SEQ ID NO: 27, SEQ ID NO: 29, SEQ ID NO: 31, SEQ ID NO: 33, SEQ ID NO: 35, SEQ ID NO: 37, SEQ ID NO: 39, SEQ ID NO: 48, SEQ ID NO: 50, SEQ ID NO: 52, SEQ ID NO: 54, SEQ ID NO: 56, SEQ ID NO: 58, SEQ ID NO: 69, SEQ ID NO: 71, SEQ ID NO: 74, SEQ ID NO : 75, SEQ ID NO: 77, SEQ ID NO: 79, SEQ ID NO: 80, SEQ ID NO: 82, SEQ ID NO: 84, SEQ ID NO: 86, SEQ ID NO: 88, SEQ ID NO: 90 , SEQ ID NO: 92, SEQ ID NO: 94, SEQ ID NO: 96, SEQ ID NO: 98, SEQ ID NO: 100, or SEQ ID NO: 102, or Accession No. 98936, 98937, 98938, 98939, 98940, 98941, 98942, 98943, 98944, 98945, 98946, 98947, 98948, 98949, No. 98 950, No. 98 951, 1 - 98 991, 1 - 98 993, 1 - is encoded by the 98 994 No. PTA-316, or a nucleic acid molecule which hybridizes to a nucleic acid molecule comprising a DNA sequence inserted in the plasmid deposited with the ATCC); And
c) SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 5, SEQ ID NO: 7, SEQ ID NO: 9, SEQ ID NO: 11, SEQ ID NO: 13, SEQ ID NO: 15, SEQ ID NO: 17, SEQ ID NO: 19, SEQ ID NO: 21, SEQ ID NO: 23, SEQ ID NO: 25, SEQ ID NO: 27, SEQ ID NO: 29, SEQ ID NO: 31, SEQ ID NO: 33, SEQ ID NO: 35, SEQ ID NO: 37, SEQ ID NO: 39, SEQ ID NO: 48, SEQ ID NO: 50, SEQ ID NO: 52, SEQ ID NO: 54, SEQ ID NO: 56, SEQ ID NO: 58, SEQ ID NO: 69, SEQ ID NO: 71, SEQ ID NO: 74, SEQ ID NO: 75, SEQ ID NO: 77, SEQ ID NO: 79, SEQ ID NO: 80, SEQ ID NO: 82, SEQ ID NO: 84, SEQ ID NO: 86, SEQ ID NO: 88, SEQ ID NO: 90, SEQ ID NO: 92, SEQ ID NO: 94, SEQ ID NO: 96, SEQ ID NO: 98, SEQ ID NO: 100, or the nucleotide sequence of SEQ ID NO: 102, or Accession Nos. 98936, 98937, 98938, 98939, 98940, 98941, 98942 , 98943, 98944, 98945, 98946, 98947, 98948, 98949, 98950, 98951, 98991, 98993, 98994 or PTA DN of plasmid deposited with ATCC as -316 A polypeptide encoded by a nucleic acid molecule comprising a nucleotide sequence that is at least 60% identical to a nucleic acid comprising an A insertion sequence; And
d) SEQ ID NO: 2, SEQ ID NO: 4, SEQ ID NO: 6, SEQ ID NO: 8, SEQ ID NO: 10, SEQ ID NO: 12, SEQ ID NO: 14, SEQ ID NO: 16, SEQ ID NO: 18, SEQ ID NO: 20, SEQ ID NO: 22, SEQ ID NO: 24, SEQ ID NO: 26, SEQ ID NO: 28, SEQ ID NO: 30, SEQ ID NO: 32, SEQ ID NO: 34, SEQ ID NO: 36, SEQ ID NO: 38, SEQ ID NO: 40, SEQ ID NO: 49, SEQ ID NO: 51, SEQ ID NO: 53, SEQ ID NO: 55, SEQ ID NO: 57, SEQ ID NO: 59, SEQ ID NO: 70, SEQ ID NO: 72, SEQ ID NO: 76, SEQ ID NO: 78, SEQ ID NO: 81, SEQ ID NO: 83, SEQ ID NO: 85, SEQ ID NO: 87, SEQ ID NO: 89, SEQ ID NO: 91, SEQ ID NO: 93, SEQ ID NO: 95, SEQ ID NO: 97, SEQ ID NO: 99, SEQ ID NO: 101, SEQ ID NO: 103, or amino acid sequence of SEQ ID NO: 109 or Accession Nos. 98936, 98937, 98938, 98939, 98940, 98941, 98942, 98943, 98944 Deposited with the ATCC as No. 98945, 98946, 98947, 98948, 98949, 98950, 98951, 98991, 98993, 98994 or PTA-316. In the DNA insertion sequence of the plasmid To the amino acid sequence and the same amino acid sequence of a polypeptide selected from the group consisting of an isolated polypeptide comprising at least 60% encoding.
[9" claim-type="Currently amended] The method of claim 8, wherein SEQ ID NO: 2, SEQ ID NO: 4, SEQ ID NO: 6, SEQ ID NO: 8, SEQ ID NO: 10, SEQ ID NO: 12, SEQ ID NO: 14, SEQ ID NO: 16, SEQ ID NO: 18, SEQ ID NO: 20, SEQ ID NO: 22, SEQ ID NO: 24, SEQ ID NO: 26, SEQ ID NO: 28, SEQ ID NO: 30, SEQ ID NO: 32, SEQ ID NO: 34, SEQ ID NO: 36, SEQ ID NO: 38, SEQ ID NO: 40, SEQ ID NO: 49, SEQ ID NO: 51, SEQ ID NO: 53, SEQ ID NO: 55, SEQ ID NO: 57, SEQ ID NO: 59, SEQ ID NO: 70, SEQ ID NO: 72, SEQ ID NO: 76, SEQ ID NO: 78, SEQ ID NO: 81, SEQ ID NO: 83, SEQ ID NO: 85, SEQ ID NO: 87, SEQ ID NO: 89, SEQ ID NO: 91, SEQ ID NO: 93, SEQ ID NO: 95, SEQ ID NO: 97, SEQ ID NO: 99, SEQ ID NO: 101, SEQ ID NO: 103, or amino acid sequence of SEQ ID NO: 109 or Accession Nos. 98936, 98937, 98938, 98939, 98940, 98941, 98942, 98943 No. 98944, 98945, 98946, 98947, 98948, 98949, 98950, 98951, 98991, 98993, 98994 or PTA-316. Of the plasmid deposited in ATCC An isolated polypeptide comprising an amino acid sequence encoded by a DNA insertion sequence.
[10" claim-type="Currently amended] 9. The polypeptide of claim 8 further comprising a heterologous amino acid sequence.
[11" claim-type="Currently amended] An antibody that selectively binds to the polypeptide of claim 8.
[12" claim-type="Currently amended] A method of producing a polypeptide selected from the group consisting of the following polypeptides comprising culturing the host cell of claim 5 under conditions in which the nucleic acid molecule is expressed:
a) SEQ ID NO: 2, SEQ ID NO: 4, SEQ ID NO: 6, SEQ ID NO: 8, SEQ ID NO: 10, SEQ ID NO: 12, SEQ ID NO: 14, SEQ ID NO: 16, SEQ ID NO: 18, SEQ ID NO: 20, SEQ ID NO: 22, SEQ ID NO: 24, SEQ ID NO: 26, SEQ ID NO: 28, SEQ ID NO: 30, SEQ ID NO: 32, SEQ ID NO: 34, SEQ ID NO: 36, SEQ ID NO: 38, SEQ ID NO: 40, SEQ ID NO: 49, SEQ ID NO: 51, SEQ ID NO: 53, SEQ ID NO: 55, SEQ ID NO: 57, SEQ ID NO: 59, SEQ ID NO: 70, SEQ ID NO: 72, SEQ ID NO: 76, SEQ ID NO: 78, SEQ ID NO: 81, SEQ ID NO: 83, SEQ ID NO: 85, SEQ ID NO: 87, SEQ ID NO: 89, SEQ ID NO: 91, SEQ ID NO: 93, SEQ ID NO: 95, SEQ ID NO: 97, SEQ ID NO: 99, SEQ ID NO: 101, SEQ ID NO: 103, or amino acid sequence of SEQ ID NO: 109 or Accession Nos. 98936, 98937, 98938, 98939, 98940, 98941, 98942, 98943, 98944 Deposited with the ATCC as No. 98945, 98946, 98947, 98948, 98949, 98950, 98951, 98991, 98993, 98994 or PTA-316. In the DNA insertion sequence of the plasmid A polypeptide comprising an amino acid sequence encoded by;
b) SEQ ID NO: 2, SEQ ID NO: 4, SEQ ID NO: 6, SEQ ID NO: 8, SEQ ID NO: 10, SEQ ID NO: 12, SEQ ID NO: 14, SEQ ID NO: 16, SEQ ID NO: 18, SEQ ID NO: 20, SEQ ID NO: 22, SEQ ID NO: 24, SEQ ID NO: 26, SEQ ID NO: 28, SEQ ID NO: 30, SEQ ID NO: 32, SEQ ID NO: 34, SEQ ID NO: 36, SEQ ID NO: 38, SEQ ID NO: 40, SEQ ID NO: 49, SEQ ID NO: 51, SEQ ID NO: 53, SEQ ID NO: 55, SEQ ID NO: 57, SEQ ID NO: 59, SEQ ID NO: 70, SEQ ID NO: 72, SEQ ID NO: 76, SEQ ID NO: 78, SEQ ID NO: 81, SEQ ID NO: 83, SEQ ID NO: 85, SEQ ID NO: 87, SEQ ID NO: 89, SEQ ID NO: 91, SEQ ID NO: 93, SEQ ID NO: 95, SEQ ID NO: 97, SEQ ID NO: 99, SEQ ID NO: 101, SEQ ID NO: 103, or amino acid sequence of SEQ ID NO: 109 or Accession Nos. 98936, 98937, 98938, 98939, 98940, 98941, 98942, 98943, 98944 Deposited with the ATCC as No. 98945, 98946, 98947, 98948, 98949, 98950, 98951, 98991, 98993, 98994 or PTA-316. In the DNA insertion sequence of the plasmid Fragment of a polypeptide comprising an amino acid sequence encoded by wherein fragment comprises SEQ ID NO: 2, SEQ ID NO: 4, SEQ ID NO: 6, SEQ ID NO: 8, SEQ ID NO: 10, SEQ ID NO: 12, SEQ ID NO: 14, SEQ ID NO: 16, SEQ ID NO: 18, SEQ ID NO: 20, SEQ ID NO: 22, SEQ ID NO: 24, SEQ ID NO: 26, SEQ ID NO: 28, SEQ ID NO: 30, SEQ ID NO: 32, SEQ ID NO: 34, SEQ ID NO: 36, SEQ ID NO: 38, SEQ ID NO: 40, SEQ ID NO: 49, SEQ ID NO: 51, SEQ ID NO: 53, SEQ ID NO: 55, SEQ ID NO: 57, SEQ ID NO: 59, SEQ ID NO: 70, SEQ ID NO: 72, SEQ ID NO: 76, SEQ ID NO: 78, SEQ ID NO: 81, SEQ ID NO: 83, SEQ ID NO: 85, SEQ ID NO: 87, SEQ ID NO: 89, SEQ ID NO: 91, SEQ ID NO: 93, SEQ ID NO: 95, SEQ ID NO: 97, SEQ ID NO: 99, SEQ ID NO: 101, SEQ ID NO: 103, or SEQ ID NO: 109 or Accession Nos. 98936, 98937, 98938, 98939, 98940, 98941 , 98942, 98943, 98944, 98945, 98946, 98947, 98948, 98949, 98950, 98951, 98991, 98993, No. 98994 It comprises a contiguous amino acids more than 15 of the amino acid sequence encoded by the DNA sequence inserted in the plasmid as deposited with the ATCC PTA-316); And
c) SEQ ID NO: 2, SEQ ID NO: 4, SEQ ID NO: 6, SEQ ID NO: 8, SEQ ID NO: 10, SEQ ID NO: 12, SEQ ID NO: 14, SEQ ID NO: 16, SEQ ID NO: 18, SEQ ID NO: 20, SEQ ID NO: 22, SEQ ID NO: 24, SEQ ID NO: 26, SEQ ID NO: 28, SEQ ID NO: 30, SEQ ID NO: 32, SEQ ID NO: 34, SEQ ID NO: 36, SEQ ID NO: 38, SEQ ID NO: 40, SEQ ID NO: 49, SEQ ID NO: 51, SEQ ID NO: 53, SEQ ID NO: 55, SEQ ID NO: 57, SEQ ID NO: 59, SEQ ID NO: 70, SEQ ID NO: 72, SEQ ID NO: 76, SEQ ID NO: 78, SEQ ID NO: 81, SEQ ID NO: 83, SEQ ID NO: 85, SEQ ID NO: 87, SEQ ID NO: 89, SEQ ID NO: 91, SEQ ID NO: 93, SEQ ID NO: 95, SEQ ID NO: 97, SEQ ID NO: 99, SEQ ID NO: 101, SEQ ID NO: 103, or amino acid sequence of SEQ ID NO: 109 or Accession Nos. 98936, 98937, 98938, 98939, 98940, 98941, 98942, 98943, 98944 Deposited with the ATCC as No. 98945, 98946, 98947, 98948, 98949, 98950, 98951, 98991, 98993, 98994 or PTA-316. In the DNA insertion sequence of the plasmid Natural allelic variants of the polypeptide comprising an amino acid sequence encoded by the polypeptide, wherein the polypeptide is subjected to stringent conditions under SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 5, SEQ ID NO: 7, SEQ ID NO: 9, SEQ ID NO: 11, SEQ ID NO: 13, SEQ ID NO: 15, SEQ ID NO: 17, SEQ ID NO: 19, SEQ ID NO: 21, SEQ ID NO: 23, SEQ ID NO: 25, SEQ ID NO: 27, SEQ ID NO: 29, SEQ ID NO: 31, SEQ ID NO: 33, SEQ ID NO: 35, SEQ ID NO: 37, SEQ ID NO: 39, SEQ ID NO: 48, SEQ ID NO: 50, SEQ ID NO: 52, SEQ ID NO: 54, SEQ ID NO: 56, SEQ ID NO: 58, SEQ ID NO: 69, SEQ ID NO: 71, SEQ ID NO: 74, SEQ ID NO: 75, SEQ ID NO: 77, SEQ ID NO: 79, SEQ ID NO: 80, SEQ ID NO: 82, SEQ ID NO: 84, SEQ ID NO: 86, SEQ ID NO: 88, SEQ ID NO: 90, SEQ ID NO: 92, SEQ ID NO: 94, SEQ ID NO: 96, SEQ ID NO: 98, SEQ ID NO: 100, or SEQ ID NO: 102, or Accession No. 98936, 98937, 98938. No. 98939, 98940, 98941, 98942, 98943, 98944, 98945, 98946, 98947, 98948, 98949, No. 98 950, No. 98 951, 1 - 98 991, 1 - 98 993, 1 - is encoded by the 98 994 No. PTA-316, or a nucleic acid molecule which hybridizes to a nucleic acid molecule comprising a DNA sequence inserted in the plasmid deposited with the ATCC).
[13" claim-type="Currently amended] a) contacting the sample with a compound that selectively binds to the polypeptide of claim 8; And
b) detecting the presence of the polypeptide of claim 8 in the sample by determining whether the compound binds to the polypeptide in the sample.
[14" claim-type="Currently amended] The method of claim 13, wherein the compound that binds to the polypeptide is an antibody.
[15" claim-type="Currently amended] A kit comprising a compound that selectively binds to the polypeptide of claim 8 and instructions for use.
[16" claim-type="Currently amended] a) contacting the sample with a nucleic acid probe or primer that selectively hybridizes to the nucleic acid molecule of claim 1; And
b) detecting the presence of the nucleic acid molecule of claim 1 in the sample by determining whether the nucleic acid probe or primer binds to the nucleic acid molecule in the sample.
[17" claim-type="Currently amended] The method of claim 16, wherein the sample comprises mRNA molecules and is contacted with a nucleic acid probe.
[18" claim-type="Currently amended] A kit comprising a compound selectively hybridized to the nucleic acid molecule of claim 1 and instructions for use.
[19" claim-type="Currently amended] a) contacting the polypeptide of claim 8 or a cell expressing such polypeptide with a test compound; And
b) identifying a compound that binds to the polypeptide of claim 8 comprising determining whether the polypeptide binds to the test compound.
[20" claim-type="Currently amended] The method of claim 19,
a) a method of detecting binding by direct detection of a test compound / polypeptide bond;
b) detecting binding using a competitive binding assay; And
c) detecting the binding of the test compound to the polypeptide by a method selected from the group consisting of detecting binding using an assay for PCIP activity.
[21" claim-type="Currently amended] A method of modulating the activity of a polypeptide of claim 8 comprising contacting the polypeptide of claim 8 or a cell expressing said polypeptide with a compound that binds said polypeptide at a concentration sufficient to modulate the activity of said polypeptide.
[22" claim-type="Currently amended] a) contacting the polypeptide of claim 8 with a test compound; And
b) identifying a compound that modulates the activity of the polypeptide of claim 8 comprising identifying a compound that modulates the activity of the polypeptide by determining the effect of the test compound on the activity of the polypeptide.
[23" claim-type="Currently amended] Identifying a compound capable of treating a disease characterized by abnormal PCIP nucleic acid expression or abnormal PCIP protein activity by assaying the ability of the compound or agent to modulate the expression of the PCIP nucleic acid molecule of claim 1 or the activity of the PCIP polypeptide of claim 8 A method for identifying a compound capable of treating a disease characterized by abnormal PCIP nucleic acid expression or abnormal PCIP protein activity.
[24" claim-type="Currently amended] The method of claim 23, wherein the disease is a CNS disease.
[25" claim-type="Currently amended] The method of claim 24, wherein the disease is epilepsy.
[26" claim-type="Currently amended] The method of claim 24, wherein the disease is spinal cerebellar ataxia.
[27" claim-type="Currently amended] The method of claim 23, wherein the disease is a cardiovascular disease.
[28" claim-type="Currently amended] The method of claim 27, wherein the cardiovascular disease is associated with abnormal I _to current.
[29" claim-type="Currently amended] A method of determining whether a subject is at risk for a disease characterized by abnormal PCIP nucleic acid expression and / or abnormal PCIP protein activity, including detecting the presence of genetic damage in a subject's cell sample. A method characterized by a change affecting the integrity of a gene encoding a PCIP polypeptide of claim 8 or a misexpression of the PCIP nucleic acid molecule of claim 1.
[30" claim-type="Currently amended] The method of claim 29, wherein the disease is a CNS disease.
[31" claim-type="Currently amended] 31. The method of claim 30, wherein the disease is epilepsy.
[32" claim-type="Currently amended] 31. The method of claim 30, wherein the disease is spinal cerebellar ataxia.
[33" claim-type="Currently amended] The method of claim 29, wherein the disease is a cardiovascular disease.
[34" claim-type="Currently amended] 34. The method of claim 33, wherein the cardiovascular disease is associated with abnormal I _to current.
[35" claim-type="Currently amended] Abnormal PCIP nucleic acid expression, including identifying a diseased subject characterized by abnormal PCIP nucleic acid expression and / or abnormal PCIP protein activity by obtaining a biological sample from the subject and detecting whether there is gene damage in the sample And / or a method for identifying a diseased subject characterized by abnormal PCIP protein activity, wherein the gene damage affects the integrity of the gene encoding the PCIP polypeptide of claim 8 or misexpression of the PCIP nucleic acid molecule of claim 1 Characterized by the above.
[36" claim-type="Currently amended] 36. The method of claim 35, wherein the disease is a CNS disease.
[37" claim-type="Currently amended] The method of claim 36, wherein the disease is epilepsy.
[38" claim-type="Currently amended] 37. The method of claim 36, wherein the disease is spinal cerebellar ataxia.
[39" claim-type="Currently amended] 36. The method of claim 35, wherein the disease is a cardiovascular disease.
[40" claim-type="Currently amended] 40. The method of claim 39, wherein the cardiovascular disease is associated with abnormal I _to current.
[41" claim-type="Currently amended] A method of treating a subject having a potassium channel related disease, comprising administering to a subject a PCIP polypeptide of claim 8 or a portion thereof for treatment to occur.
[42" claim-type="Currently amended] 42. The method of claim 41, wherein the disease is a CNS disease.
[43" claim-type="Currently amended] 43. The method of claim 42, wherein the disease is epilepsy.
[44" claim-type="Currently amended] 43. The method of claim 42, wherein the disease is spinal cerebellar ataxia.
[45" claim-type="Currently amended] 42. The method of claim 41, wherein the disease is a cardiovascular disease.
[46" claim-type="Currently amended] 46. The method of claim 45, wherein the cardiovascular disease is associated with abnormal I _to current.
[47" claim-type="Currently amended] A method of treating a subject having a potassium channel related disease, comprising administering to a subject a nucleic acid encoding the PCIP polypeptide of claim 8 or a portion thereof for treatment to occur.
[48" claim-type="Currently amended] 48. The method of claim 47, wherein the disease is a CNS disease.
[49" claim-type="Currently amended] 49. The method of claim 48, wherein the disease is epilepsy.
[50" claim-type="Currently amended] 49. The method of claim 48, wherein the disease is spinal cerebellar ataxia.
[51" claim-type="Currently amended] 48. The method of claim 47, wherein the disease is a cardiovascular disease.
[52" claim-type="Currently amended] 53. The method of claim 51, wherein the cardiovascular disease is associated with abnormal I _to current.
[53" claim-type="Currently amended] Use of a compound identified by the method of claim 23 for use in treating potassium channel related diseases.

类似技术:

---

公开号 | 公开日 | 专利标题

---

US9828590B2|2017-11-28|Molecules of the card-related protein family and uses thereof

---

US8445233B2|2013-05-21|PGC-1β, a novel PGC-1 homologue and uses therefor

---

AU747798B2|2002-05-23|G-protein coupled receptors and uses therefor

---

US6291193B1|2001-09-18|MTbx protein and nucleic acid molecules and uses therefor

---

US6613521B1|2003-09-02|Molecules of the card-related protein family and uses thereof

---

US8076086B2|2011-12-13|Methods of modulating the activity of TANGO332

---

US6623947B2|2003-09-23|Human glucose-6-phosphatase molecules and uses thereof

---

US8754199B2|2014-06-17|Tango 240 nucleic acids and uses thereof

---

US20110230392A1|2011-09-22|Novel narc sc1, narc 10a, narc 1, narc 12, narc 13, narc17, narc 25, narc 3, narc 4, narc 7, narc 8, narc 11, narc 14a, narc 15, narc 16, narc 19, narc 20, narc 26, narc 27, narc 28, narc 30, narc 5, narc 6, narc 9, narc 10c, narc 8b, narc 9, narc2a, narc 16b, narc1c, narc 1a, and narc 25 molecules and uses therefor

---

US6756196B2|2004-06-29|Molecules of the card-related protein family and uses thereof

---

US20020103360A1|2002-08-01|Novel protein related to melanoma-inhibiting protein and uses thereof

---

US20030180784A1|2003-09-25|Novel human Delta3 compositions and therapeutic and diagnostic uses therefor

---

US20020119517A1|2002-08-29|Leptin induced genes

---

US20020142377A1|2002-10-03|18607, a novel human calcium channel

---

US7459530B2|2008-12-02|Tango 405 polypeptides and uses thereof

---

JP2003512840A|2003-04-08|Rat brain-derived nucleic acid molecules and programmed cell death models

---

JP2010227110A|2010-10-14|Crsp protein, nucleic acid molecule encoding the same and use thereof

---

AU2148000A|2000-06-05|Novel members of the capsaicin/vanilloid receptor family of proteins and uses thereof

---

US20050079550A1|2005-04-14|Isolated protein molecule, flh2882, a GPCR showing homology to the 5HT family of receptors

---

US20050250182A1|2005-11-10|Novel genes, compositions, and methods for modulating the unfolded protein response

---

AU751396B2|2002-08-15|Novel molecules of the Tango-77 related protein family and uses thereof

---

US20020156253A1|2002-10-24|48000 and 52920, novel human calcium channels and uses thereof

---

US20030232378A1|2003-12-18|Novel toll molecules and uses therefor

---

US5942420A|1999-08-24|Molecules of the follistatin-related protein family and uses therefor

---

US20020061590A1|2002-05-23|38594, a novel human transporter and uses thereof

同族专利:

---

公开号 | 公开日

---

JP2004525610A|2004-08-26|

---

MXPA03002557A|2004-09-10|

---

NO20031369L|2003-05-22|

---

EP1322759A2|2003-07-02|

---

WO2002026984A2|2002-04-04|

---

CZ20031154A3|2003-09-17|

---

CN1498271A|2004-05-19|

---

AU9639301A|2002-04-08|

---

WO2002026984A3|2003-03-13|

---

BR0114383A|2005-04-12|

---

IL154962D0|2003-10-31|

---

EA200300420A1|2004-04-29|

---

NO20031369D0|2003-03-26|

---

CA2420960A1|2002-04-04|

引用文献:

---

公开号 | 申请日 | 公开日 | 申请人 | 专利标题

---

法律状态:
2000-09-27|Priority to US09/670,756

---

2000-09-27|Priority to US09/670,756

---

2000-10-31|Priority to US09/703,094

---

2000-10-31|Priority to US09/703,094

---

2001-09-27|Application filed by 밀레니엄 파머슈티컬스 인코퍼레이티드

---

2001-09-27|Priority to PCT/US2001/030463

---

2003-09-19|Publication of KR20030074604A

优先权:

---

申请号 | 申请日 | 专利标题

---

US09/670,756|2000-09-27|

---

US09/670,756|US7078481B1|1998-11-20|2000-09-27|Potassium channel interactors and uses therefor|

---

US09/703,094|US7556938B1|1998-11-20|2000-10-31|Nucleic acids encoding potassium channel interactors|

---

US09/703,094|2000-10-31|

---

PCT/US2001/030463|WO2002026984A2|2000-09-27|2001-09-27|Potassium channel interactors and uses therefor|